Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29898
Trapped Gene
Fkbp4 (ENSMUSG00000030357)
Vector Insertion
Chr 6: 128386587 - 128388650
Public Clones E030C05 (ggtc) E026C05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000371281 (Chr6:128388424..128388649 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCTCGAAGGAGTGGACAT Chr6:128388455..128388474 59.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000371281 (Chr6:128388424..128388649 -)
Downstram Exon
ENSMUSE00000197796 (Chr6:128386588..128386732 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCTCGAAGGAGTGGACAT Chr6:128388455..128388474 59.25 55 CCAGCCAGTGTAGTGGACAA Chr6:128386636..128386655 59.74 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371281 Chr6:128388424..128388649 CCTCTCGAAGGAGTGGACAT Chr6:128388455..128388474 59.25 55
upstream ENSMUSE00000197796 Chr6:128386588..128386732 ACACTGGCTGGCTGCTAGAT Chr6:128386649..128386668 60.04 55

*** Putative Vector Insertion (Chr 6: 128386587 - 128388650) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197797 Chr6:128385732..128385874 CTGCGCCATAGGCATATTCT Chr6:128385757..128385776 60.22 50
downstream ENSMUSE00000197793 Chr6:128384770..128384890 GTCCGTATTCTGCGGATGAT Chr6:128384795..128384814 59.92 50
downstream ENSMUSE00000197800 Chr6:128384323..128384479 TGAGGTACACGATGGAATGC Chr6:128384308..128384327 59.53 50
downstream ENSMUSE00000197798 Chr6:128383721..128383811 AGCCGCACTTCATACCTCAG Chr6:128383715..128383734 60.42 55
downstream ENSMUSE00000550283 Chr6:128383544..128383627 ATGTTGCTCTGCTCCAGCTT Chr6:128383553..128383572 60.16 50
downstream ENSMUSE00000197799 Chr6:128383124..128383309 GCCTGCTTGTACTTGCCTTC Chr6:128383268..128383287 60.02 55
downstream ENSMUSE00000197802 Chr6:128382440..128382679 GCTCTTGCCAGGTCAAAGTC Chr6:128382569..128382588 60 55
downstream ENSMUSE00000396358 Chr6:128380125..128380898 GGCTACGCTTCTGTCTCCAC Chr6:128380770..128380789 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr6:128388579..128388599 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000030357