Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29900
Trapped Gene
Zgpat (ENSMUSG00000027582)
Vector Insertion
Chr 2: 181115079 - 181115500
Public Clones E028E03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000360025 (Chr2:181115080..181115499 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATGCCTAAACAGCACCTG Chr2:181115294..181115313 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000360025 (Chr2:181115080..181115499 +)
Downstram Exon
ENSMUSE00000706035 (Chr2:181115080..181116099 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATGCCTAAACAGCACCTG Chr2:181115294..181115313 59.86 50 GCAGGTGAACTGGATGGATT Chr2:181115840..181115859 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000483315 Chr2:181099633..181100081 ACCATCAATTCGGAGTCCTG Chr2:181099644..181099663 59.93 50
upstream ENSMUSE00000706037 Chr2:181100110..181100957 GGAACTGAGCGGTGCTAAAG Chr2:181100754..181100773 60.01 55
upstream ENSMUSE00000712878 Chr2:181100128..181100957 GGAACTGAGCGGTGCTAAAG Chr2:181100754..181100773 60.01 55
upstream ENSMUSE00000715308 Chr2:181100128..181100957 GGAACTGAGCGGTGCTAAAG Chr2:181100754..181100773 60.01 55
upstream ENSMUSE00000330410 Chr2:181100350..181100957 GGAACTGAGCGGTGCTAAAG Chr2:181100754..181100773 60.01 55
upstream ENSMUSE00000170819 Chr2:181113088..181113221 GGCAGGTGGTATCTGTGGAT Chr2:181113099..181113118 59.81 55
upstream ENSMUSE00000678111 Chr2:181113088..181113221 GGCAGGTGGTATCTGTGGAT Chr2:181113099..181113118 59.81 55
upstream ENSMUSE00000170820 Chr2:181113456..181113611 TGACTCATTGCTGCTGAAGG Chr2:181113487..181113506 60.14 50
upstream ENSMUSE00000678110 Chr2:181113456..181113611 TGACTCATTGCTGCTGAAGG Chr2:181113487..181113506 60.14 50
upstream ENSMUSE00000170816 Chr2:181114275..181114394 GCTCCAAACTCCTCGTCAAG Chr2:181114353..181114372 59.99 55
upstream ENSMUSE00000678109 Chr2:181114275..181114394 GCTCCAAACTCCTCGTCAAG Chr2:181114353..181114372 59.99 55
upstream ENSMUSE00000170813 Chr2:181114479..181114884 ACATGTATCACGCCAGCAAG Chr2:181114755..181114774 59.75 50
upstream ENSMUSE00000545552 Chr2:181114479..181114888 ACATGTATCACGCCAGCAAG Chr2:181114755..181114774 59.75 50
upstream ENSMUSE00000715726 Chr2:181114479..181114884 ACATGTATCACGCCAGCAAG Chr2:181114755..181114774 59.75 50
upstream ENSMUSE00000720136 Chr2:181114479..181114884 ACATGTATCACGCCAGCAAG Chr2:181114755..181114774 59.75 50

*** Putative Vector Insertion (Chr 2: 181115079 - 181115500) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000360025 Chr2:181115080..181115499 CTAAGAAGGGGCTGGTTCCT Chr2:181115340..181115359 59.71 55
downstream ENSMUSE00000678088 Chr2:181115080..181116099 GCAGGTGAACTGGATGGATT Chr2:181115840..181115859 59.93 50
downstream ENSMUSE00000706035 Chr2:181115080..181116099 GCAGGTGAACTGGATGGATT Chr2:181115840..181115859 59.93 50
downstream ENSMUSE00000706036 Chr2:181115080..181115487 CTAAGAAGGGGCTGGTTCCT Chr2:181115340..181115359 59.71 55
downstream ENSMUSE00000330348 Chr2:181115940..181117019 ACTTGCAGATCTTGCCCACT Chr2:181116840..181116859 59.87 50
downstream ENSMUSE00000710737 Chr2:181115940..181117019 ACTTGCAGATCTTGCCCACT Chr2:181116840..181116859 59.87 50
downstream ENSMUSE00000712458 Chr2:181116899..181117019 AGAGAGCTAGTGGGGCTGAA Chr2:181116961..181116980 59.19 55
downstream ENSMUSE00000717551 Chr2:181116899..181117019 AGAGAGCTAGTGGGGCTGAA Chr2:181116961..181116980 59.19 55
downstream ENSMUSE00000330341 Chr2:181117192..181117249 TCCACTGGTACCAAACTGTCC Chr2:181117247..181117267 59.88 52.38
downstream ENSMUSE00000706033 Chr2:181117192..181117249 TCCACTGGTACCAAACTGTCC Chr2:181117247..181117267 59.88 52.38
downstream ENSMUSE00000330335 Chr2:181117321..181117408 TGGTGTCAGACTTGCTGAGG Chr2:181117372..181117391 60.02 55
downstream ENSMUSE00000706032 Chr2:181117321..181117408 TGGTGTCAGACTTGCTGAGG Chr2:181117372..181117391 60.02 55
downstream ENSMUSE00000545545 Chr2:181117494..181117868 CCAAGCCTGGCACAACTAAT Chr2:181117771..181117790 60.13 50
downstream ENSMUSE00000330330 Chr2:181117504..181117865 CCAAGCCTGGCACAACTAAT Chr2:181117771..181117790 60.13 50
downstream ENSMUSE00000706031 Chr2:181117504..181117865 CCAAGCCTGGCACAACTAAT Chr2:181117771..181117790 60.13 50
downstream ENSMUSE00000365932 Chr2:181117963..181118333 GATGGCCTCGTACTCCACAT Chr2:181118094..181118113 59.96 55
downstream ENSMUSE00000678071 Chr2:181117963..181118328 GATGGCCTCGTACTCCACAT Chr2:181118094..181118113 59.96 55
downstream ENSMUSE00000678097 Chr2:181117963..181118328 GATGGCCTCGTACTCCACAT Chr2:181118094..181118113 59.96 55
downstream ENSMUSE00000706030 Chr2:181117963..181118328 GATGGCCTCGTACTCCACAT Chr2:181118094..181118113 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTGCAGGAGAAGCTGGAG Chr2:181115101..181115121 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTGCAGGAGAAGCTGGAG Chr2:181115101..181115121 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027582