Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29907
Trapped Gene
Xbp1 (ENSMUSG00000020484)
Vector Insertion
Chr 11: 5421204 - 5421925
Public Clones E024H07 (ggtc) E024H07 (ggtc) IST10115E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000403710 (Chr11:5420989..5421203 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000403710 (Chr11:5420989..5421203 +)
Downstram Exon
ENSMUSE00000105255 (Chr11:5421926..5422022 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000403710 Chr11:5420989..5421203 No primer for this exon

*** Putative Vector Insertion (Chr 11: 5421204 - 5421925) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000105255 Chr11:5421926..5422022 No primer for this exon
downstream ENSMUSE00000105261 Chr11:5423336..5423470 No primer for this exon
downstream ENSMUSE00000370964 Chr11:5424242..5424387 No primer for this exon
downstream ENSMUSE00000681883 Chr11:5424242..5424284 No primer for this exon
downstream ENSMUSE00000681882 Chr11:5424311..5424387 No primer for this exon
downstream ENSMUSE00000594887 Chr11:5424688..5425877 No primer for this exon
downstream ENSMUSE00000681881 Chr11:5424688..5425877 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTGGTAATCGCCTTGCAG Chr11:5421249..5421269 60.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTGGCGTGACTGGGAAAAC Chr11:5421249..5421270 63.93 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020484