Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29908
Trapped Gene
l7Rn6 (ENSMUSG00000062797)
Vector Insertion
Chr 7: 97088489 - 97089595
Public Clones (sanger) D079H11 (ggtc) E024G07 (ggtc) D070E02 (ggtc) E023G07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672472 (Chr7:97089479..97089594 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672472 (Chr7:97089479..97089594 -)
Downstram Exon
ENSMUSE00000672471 (Chr7:97088490..97088553 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACAGGAGCCTCCCATTCACT Chr7:97088472..97088491 61.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000489415 Chr7:97089479..97089695 TAGTGGAGGGTCACGTTCCT Chr7:97089619..97089638 59.57 55
upstream ENSMUSE00000672472 Chr7:97089479..97089594 No primer for this exon
upstream ENSMUSE00000713514 Chr7:97089479..97089709 GAGGCGTGCAAGTTAGGAAG Chr7:97089685..97089704 60.01 55
upstream ENSMUSE00000672471 Chr7:97088490..97088553 GGTTCCAAGAAACCATGGAC Chr7:97088524..97088543 59.24 50

*** Putative Vector Insertion (Chr 7: 97088489 - 97089595) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000477314 Chr7:97084237..97084474 AAATCCTAGGAGCTGCCACA Chr7:97084267..97084286 59.84 50
downstream ENSMUSE00000487322 Chr7:97072074..97072225 AAAGGAGTCAACGGAGGACA Chr7:97072058..97072077 59.7 50
downstream ENSMUSE00000713158 Chr7:97072074..97072225 AAAGGAGTCAACGGAGGACA Chr7:97072058..97072077 59.7 50
downstream ENSMUSE00000490457 Chr7:97068583..97068701 TGCTGGGATGAACATTTCTG Chr7:97068578..97068597 59.65 45
downstream ENSMUSE00000711507 Chr7:97067434..97067517 TTTCCAAAAGAGGGGGTTCT Chr7:97067447..97067466 59.91 45
downstream ENSMUSE00000672470 Chr7:97067430..97067517 TTTCCAAAAGAGGGGGTTCT Chr7:97067447..97067466 59.91 45
downstream ENSMUSE00000515882 Chr7:97067199..97067517 TTTCCAAAAGAGGGGGTTCT Chr7:97067447..97067466 59.91 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACGTTCCTTCCTGCAAAT Chr7:97089607..97089627 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACGTTCCTTCCTGCAAAT Chr7:97089607..97089627 60.64 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062797