Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29909
Trapped Gene
Elavl1 (ENSMUSG00000040028)
Vector Insertion
Chr 8: 4312556 - 4324907
Public Clones (sanger) D113D10 (ggtc) D040B05 (ggtc) D113A09 (ggtc) E023D10 (ggtc)
D040B05 (ggtc) IST14995B5 (tigm) IST14306H7 (tigm) IST15073C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706646 (Chr8:4324886..4324906 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706646 (Chr8:4324886..4324906 -)
Downstram Exon
ENSMUSE00000706645 (Chr8:4312557..4312614 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638320 Chr8:4324886..4325086 No primer for this exon
upstream ENSMUSE00000706646 Chr8:4324886..4324906 No primer for this exon
upstream ENSMUSE00000706645 Chr8:4312557..4312614 No primer for this exon

*** Putative Vector Insertion (Chr 8: 4312556 - 4324907) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000229444 Chr8:4311599..4311786 CCCGAATAAGCTTTGCAGAT Chr8:4311589..4311608 59.32 45
downstream ENSMUSE00000229435 Chr8:4304927..4305030 GTCTCAAGCCGTTCAGTGTG Chr8:4304925..4304944 59.47 55
downstream ENSMUSE00000229429 Chr8:4301685..4301838 AGTTGATGATTCGCCCAAAC Chr8:4301690..4301709 59.94 45
downstream ENSMUSE00000278547 Chr8:4295336..4295561 CTGCTTCTGACCGTTTGTCA Chr8:4295489..4295508 60.03 50
downstream ENSMUSE00000638319 Chr8:4288347..4289924 ACAGAACCCCAAACGTCAAG Chr8:4288409..4288428 60.01 50
downstream ENSMUSE00000706644 Chr8:4288344..4289924 ACAGAACCCCAAACGTCAAG Chr8:4288409..4288428 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr8:4318836..4318856 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTTTGCCCCTGAAAGTA Chr8:4318888..4318908 60.25 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040028