Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29934
Trapped Gene
Zcchc7 (ENSMUSG00000035649)
Vector Insertion
Chr 4: 44769565 - 44774721
Public Clones D188B12 (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000418496 (Chr4:44769440..44769564 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGCTTCCTTACCTCATTTG Chr4:44769476..44769495 59.7 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000418496 (Chr4:44769440..44769564 +)
Downstram Exon
ENSMUSE00000713624 (Chr4:44774722..44775346 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGCTTCCTTACCTCATTTG Chr4:44769476..44769495 59.7 50 ATGACCTCTCGGATCACACC Chr4:44775197..44775216 59.93 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418496 Chr4:44769440..44769564 CGGCTTCCTTACCTCATTTG Chr4:44769476..44769495 59.7 50

*** Putative Vector Insertion (Chr 4: 44769565 - 44774721) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000412283 Chr4:44774722..44775346 ATGACCTCTCGGATCACACC Chr4:44775197..44775216 59.93 55
downstream ENSMUSE00000713624 Chr4:44774722..44775346 ATGACCTCTCGGATCACACC Chr4:44775197..44775216 59.93 55
downstream ENSMUSE00000418240 Chr4:44906405..44906442 No primer for this exon
downstream ENSMUSE00000286458 Chr4:44907788..44907913 TTGTGGTAAGGGGCAGTTTT Chr4:44907916..44907935 59.47 45
downstream ENSMUSE00000286450 Chr4:44908691..44908861 TCACATCGGTCACATCGTTT Chr4:44908842..44908861 59.97 45
downstream ENSMUSE00000527451 Chr4:44921323..44924931 TCGCCTAGTAAAAGGGCTGA Chr4:44923105..44923124 59.97 50
downstream ENSMUSE00000674536 Chr4:44921323..44921358 CGTTAGGTGATACTGCCTCCA Chr4:44921360..44921380 60.14 52.38
downstream ENSMUSE00000674532 Chr4:44937042..44938942 GCAGGCATAGGTGAGAGAGG Chr4:44938019..44938038 59.97 60
downstream ENSMUSE00000674534 Chr4:44938847..44938942 TTGTCCAGAAGGGGTCTTTG Chr4:44938894..44938913 60.08 50
downstream ENSMUSE00000286404 Chr4:44941990..44942107 TTCGCTTTATTCTCCGATCC Chr4:44942101..44942120 59.25 45
downstream ENSMUSE00000286396 Chr4:44943908..44945074 CAGAGACCACTCGGCTTAGG Chr4:44944349..44944368 60.01 60
downstream ENSMUSE00000674533 Chr4:44943908..44945087 CAGAGACCACTCGGCTTAGG Chr4:44944349..44944368 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGCAGTGAGTATGTGTGTG Chr4:44772561..44772581 58.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGCAGTGAGTATGTGTGTG Chr4:44772561..44772581 58.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035649