Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29936
Trapped Gene
Ifitm1 (ENSMUSG00000025491)
Vector Insertion
Chr 7: 148153951 - 148154138
Public Clones D187F01 (ggtc) IST15082A5 (tigm) IST14424F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668375 (Chr7:148153927..148153950 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668375 (Chr7:148153927..148153950 +)
Downstram Exon
ENSMUSE00000668379 (Chr7:148154139..148154337 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCATCTCTCGGCTTTTGAAG Chr7:148154161..148154180 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668380 Chr7:148153120..148153465 CCCAACGGACCTCTGTAGAA Chr7:148153330..148153349 60.1 55
upstream ENSMUSE00000668375 Chr7:148153927..148153950 No primer for this exon

*** Putative Vector Insertion (Chr 7: 148153951 - 148154138) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151124 Chr7:148154131..148154337 GCATCTCTCGGCTTTTGAAG Chr7:148154161..148154180 60.1 50
downstream ENSMUSE00000668379 Chr7:148154139..148154337 GCATCTCTCGGCTTTTGAAG Chr7:148154161..148154180 60.1 50
downstream ENSMUSE00000151125 Chr7:148155388..148155724 AATGGCACAGACAACGATGA Chr7:148155522..148155541 60.12 45
downstream ENSMUSE00000668378 Chr7:148155388..148155717 AATGGCACAGACAACGATGA Chr7:148155522..148155541 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCCCCTAAAAAGCACTA Chr7:148153984..148154004 59.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000025491