Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29940
Trapped Gene
Rab27b (ENSMUSG00000024511)
Vector Insertion
Chr 18: 70212779 - 70301048
Public Clones D186G05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720308 (Chr18:70300972..70301047 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGATCTGGAAGCGTTTG Chr18:70300977..70300996 59.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720308 (Chr18:70300972..70301047 -)
Downstram Exon
ENSMUSE00000714403 (Chr18:70212780..70213242 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGATCTGGAAGCGTTTG Chr18:70300977..70300996 59.44 50 GCGTGTCCCTGAGTCCTAAC Chr18:70213054..70213073 59.73 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000719559 Chr18:70301178..70301259 GACTGAGCCGGTTTAGCTGT Chr18:70301239..70301258 59.5 55
upstream ENSMUSE00000720308 Chr18:70300972..70301047 CTGTGATCTGGAAGCGTTTG Chr18:70300977..70300996 59.44 50
upstream ENSMUSE00000497864 Chr18:70212780..70213022 CAGAGGTTGGGGACTGTCTG Chr18:70212963..70212982 60.7 60
upstream ENSMUSE00000714403 Chr18:70212780..70213242 ACATCCGCGTTAGGACTCAG Chr18:70213084..70213103 60.28 55

*** Putative Vector Insertion (Chr 18: 70212779 - 70301048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000717191 Chr18:70209092..70209262 TATCTGAGCGCACTGTTCCA Chr18:70209131..70209150 60.56 50
downstream ENSMUSE00000379179 Chr18:70155723..70155894 GTTGTCTTCCCGACTCCTGA Chr18:70155783..70155802 60.24 55
downstream ENSMUSE00000722085 Chr18:70155723..70155894 GTTGTCTTCCCGACTCCTGA Chr18:70155783..70155802 60.24 55
downstream ENSMUSE00000142993 Chr18:70154131..70154216 CTTTTCCTGACGCTCCATCT Chr18:70154155..70154174 59.43 50
downstream ENSMUSE00000142992 Chr18:70149198..70149301 GCTCTGTTGACTGGTGAGGTC Chr18:70149201..70149221 59.9 57.14
downstream ENSMUSE00000142989 Chr18:70146566..70146689 CTTGCCGTTCATTGACTTCC Chr18:70146569..70146588 60.64 50
downstream ENSMUSE00000363506 Chr18:70143322..70145031 CCACCCACGACTTTACCAGT Chr18:70144284..70144303 59.88 55
downstream ENSMUSE00000716772 Chr18:70143310..70145031 CCACCCACGACTTTACCAGT Chr18:70144284..70144303 59.88 55
downstream ENSMUSE00000710554 Chr18:70138785..70145031 AGCTGAGACGCAGATCCATT Chr18:70143516..70143535 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCTATTTCTAATCGCCTTG Chr18:70216986..70217007 59.35 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACATATTCCGCGTGACTGG Chr18:70216988..70217008 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024511