Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29946
Trapped Gene
Ankrd6 (ENSMUSG00000040183)
Vector Insertion
Chr 4: 32961181 - 33010481
Public Clones (sanger) D183F08 (ggtc) (ggtc) D072H04 (ggtc) 5SE287C05 (ggtc)
(ggtc) D183F08 (ggtc) D072H04 (ggtc) (ggtc) (ggtc) IST13974A12 (tigm)
IST13269D7 (tigm) IST10834G12 (tigm) IST14555D9 (tigm) IST14888C3 (tigm)
IST11608C6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000528122 (Chr4:33010272..33010480 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGAGACTGGACGGAAGGT Chr4:33010372..33010391 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000528122 (Chr4:33010272..33010480 -)
Downstram Exon
ENSMUSE00000495723 (Chr4:32961182..32961345 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGAGACTGGACGGAAGGT Chr4:33010372..33010391 59.83 55 TAGGCCGCTCTCCAGAATAA Chr4:32961208..32961227 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000528126 Chr4:33037722..33037801 No primer for this exon
upstream ENSMUSE00000675831 Chr4:33037722..33037816 No primer for this exon
upstream ENSMUSE00000500655 Chr4:33010276..33010480 TCTGAGACTGGACGGAAGGT Chr4:33010372..33010391 59.83 55
upstream ENSMUSE00000528122 Chr4:33010272..33010480 TCTGAGACTGGACGGAAGGT Chr4:33010372..33010391 59.83 55
upstream ENSMUSE00000495723 Chr4:32961182..32961345 TTATTCTGGAGAGCGGCCTA Chr4:32961230..32961249 59.94 50

*** Putative Vector Insertion (Chr 4: 32961181 - 33010481) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235928 Chr4:32947297..32947563 ATCCTGAGGGATGCCTTTCT Chr4:32947502..32947521 60.04 50
downstream ENSMUSE00000675830 Chr4:32947297..32947417 CTTGGTAACGGCTACCTTGG Chr4:32947275..32947294 59.63 55
downstream ENSMUSE00000710696 Chr4:32947297..32947563 ATCCTGAGGGATGCCTTTCT Chr4:32947502..32947521 60.04 50
downstream ENSMUSE00000235918 Chr4:32923310..32923408 CAGCAAAATCTGCACCACAG Chr4:32923321..32923340 60.45 50
downstream ENSMUSE00000235909 Chr4:32915685..32915783 GCTGTGAGGATCTCGGTGTT Chr4:32915703..32915722 60.27 55
downstream ENSMUSE00000235903 Chr4:32914064..32914162 TGTTTCTGGCAAGCACATTG Chr4:32914044..32914063 60.84 45
downstream ENSMUSE00000235898 Chr4:32911371..32911469 No primer for this exon
downstream ENSMUSE00000235889 Chr4:32910381..32910479 TGACGACGGACAAGTGGTTA Chr4:32910403..32910422 60.15 50
downstream ENSMUSE00000235882 Chr4:32909128..32909226 TCACAATGGTTGTGTCAGCA Chr4:32909111..32909130 59.71 45
downstream ENSMUSE00000235875 Chr4:32908232..32908309 TTATTGTGGTAGCGGGCAGT Chr4:32908247..32908266 60.52 50
downstream ENSMUSE00000235869 Chr4:32905580..32905684 CCCTCCTCTCTTCCTTGAGC Chr4:32905596..32905615 60.47 60
downstream ENSMUSE00000235864 Chr4:32904394..32904525 GGAAGCTGGTGGACAATCTC Chr4:32904417..32904436 59.66 55
downstream ENSMUSE00000235854 Chr4:32903886..32904071 CTTTTGGTGTCCAGGCTGTT Chr4:32903993..32904012 60.15 50
downstream ENSMUSE00000235848 Chr4:32902210..32902362 TATCCTGCACCGAGCCTAAC Chr4:32902235..32902254 60.24 55
downstream ENSMUSE00000235840 Chr4:32897173..32897286 TTCCACCATCAGTTTGTCCA Chr4:32897235..32897254 59.94 45
downstream ENSMUSE00000235830 Chr4:32895659..32895785 GAGTCAGACGGAGGTGGTGT Chr4:32895645..32895664 60.16 60
downstream ENSMUSE00000675832 Chr4:32893088..32893602 CTTATCCTTGGGCCTCACAA Chr4:32893516..32893535 60.07 50
downstream ENSMUSE00000675829 Chr4:32892715..32893602 TCACTGAATCGCAGACTTGG Chr4:32892817..32892836 59.98 50
downstream ENSMUSE00000361839 Chr4:32891010..32893617 TCACTGAATCGCAGACTTGG Chr4:32892817..32892836 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCTACCTGTGACCGAACAG Chr4:32995458..32995479 60.16 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTTCGTGACTGGGAAAACC Chr4:32995414..32995435 60.91 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040183