Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29966
Trapped Gene
Mark2 (ENSMUSG00000024969)
Vector Insertion
Chr 19: 7349885 - 7352577
Public Clones D175F10 (ggtc) D175F10 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000550704 (Chr19:7352532..7352576 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCAAAGACCGAGTGGAGA Chr19:7352539..7352558 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000550704 (Chr19:7352532..7352576 -)
Downstram Exon
ENSMUSE00000550701 (Chr19:7349886..7351940 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCAAAGACCGAGTGGAGA Chr19:7352539..7352558 59.99 50 GATCTCCCGCATCATCTCAT Chr19:7351783..7351802 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695304 Chr19:7415658..7416334 AACCTCGGTCTTCGGAATCT Chr19:7416262..7416281 60.07 50
upstream ENSMUSE00000695218 Chr19:7369528..7369927 TGGAAGTCGCTGGTAGTCCT Chr19:7369547..7369566 59.87 55
upstream ENSMUSE00000695217 Chr19:7365093..7365272 ACCGGCTCCTTAAGACCATT Chr19:7365150..7365169 59.96 50
upstream ENSMUSE00000695301 Chr19:7365093..7365272 ACCGGCTCCTTAAGACCATT Chr19:7365150..7365169 59.96 50
upstream ENSMUSE00000146730 Chr19:7364806..7364859 ATCGACAAGACCCAGCTGAA Chr19:7364825..7364844 60.8 50
upstream ENSMUSE00000146723 Chr19:7361820..7361868 AGGTTTTGAATCATCCCAACA Chr19:7361823..7361843 59.28 38.1
upstream ENSMUSE00000146738 Chr19:7361491..7361556 TTGTTTGAAGTGATCGAGACTGA Chr19:7361529..7361551 59.91 39.13
upstream ENSMUSE00000146735 Chr19:7361324..7361394 AAAAAGAAGCTCGAGCCAAA Chr19:7361333..7361352 59.22 40
upstream ENSMUSE00000146737 Chr19:7361059..7361115 No primer for this exon
upstream ENSMUSE00000146736 Chr19:7360222..7360458 AGCAACGAATTCACCTTTGG Chr19:7360382..7360401 60.11 45
upstream ENSMUSE00000146729 Chr19:7359359..7359478 CATGTCCACGGACTGTGAAA Chr19:7359412..7359431 60.57 50
upstream ENSMUSE00000695224 Chr19:7359177..7359249 GAAAGATCGGTGGATGAACG Chr19:7359222..7359241 60.46 50
upstream ENSMUSE00000146726 Chr19:7359150..7359249 AAGATCGGTGGATGAACGTG Chr19:7359220..7359239 60.92 50
upstream ENSMUSE00000486614 Chr19:7359043..7359089 TGATGGTGTCAATGGGTTACA Chr19:7359044..7359064 59.68 42.86
upstream ENSMUSE00000550698 Chr19:7358955..7359067 ACACACGGGAAGAGATCCAG Chr19:7359027..7359046 60.11 55
upstream ENSMUSE00000550711 Chr19:7358955..7359038 GATCCAGGACTCGCTGGTAG Chr19:7359014..7359033 59.83 60
upstream ENSMUSE00000550710 Chr19:7357926..7358058 CGGCCTTCAGCTGATCTAAC Chr19:7358009..7358028 59.98 55
upstream ENSMUSE00000550709 Chr19:7357523..7357695 AAATAAGCGGCCTGAGGAAG Chr19:7357615..7357634 60.7 50
upstream ENSMUSE00000550708 Chr19:7357216..7357313 AGCAGGAACTCCCCACTTTT Chr19:7357264..7357283 60.11 50
upstream ENSMUSE00000550707 Chr19:7356288..7356449 CCCCACGGAGAGTAACTGTG Chr19:7356304..7356323 60.56 60
upstream ENSMUSE00000550706 Chr19:7355488..7355745 GTGTCCAGTCGAAGCACCTT Chr19:7355632..7355651 60.31 55
upstream ENSMUSE00000643494 Chr19:7354476..7354502 TGTCTTTCAGGTTTGCCAGA Chr19:7354478..7354497 59.42 45
upstream ENSMUSE00000550704 Chr19:7352532..7352576 AAGCAAAGACCGAGTGGAGA Chr19:7352539..7352558 59.99 50
upstream ENSMUSE00000550701 Chr19:7349886..7351940 GCTAACCTCTGAGGCCAGTG Chr19:7350465..7350484 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGGAGACGCTCAGGTGAT Chr19:7352525..7352545 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAGCAAAGACCGAGTGGA Chr19:7352539..7352559 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024969