Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29976
Trapped Gene
Zdhhc9 (ENSMUSG00000036985)
Vector Insertion
Chr X: 45559844 - 45561861
Public Clones D170G09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370686 (ChrX:45561657..45561860 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGTCGCTACCACCTCTGG ChrX:45561733..45561752 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370686 (ChrX:45561657..45561860 -)
Downstram Exon
ENSMUSE00000710720 (ChrX:45559845..45560134 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGTCGCTACCACCTCTGG ChrX:45561733..45561752 59.87 60 CCATTTCCGTGTCACCTTCT ChrX:45559948..45559967 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000624101 ChrX:45562015..45562055 CAGACCCCAGAGAGAAGCTG ChrX:45562030..45562049 60.13 60
upstream ENSMUSE00000370686 ChrX:45561657..45561860 GAAGTCGCTACCACCTCTGG ChrX:45561733..45561752 59.87 60
upstream ENSMUSE00000413808 ChrX:45559845..45560134 AGAAGGTGACACGGAAATGG ChrX:45559970..45559989 59.97 50
upstream ENSMUSE00000710720 ChrX:45559845..45560134 AGAAGGTGACACGGAAATGG ChrX:45559970..45559989 59.97 50

*** Putative Vector Insertion (Chr X: 45559844 - 45561861) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000321061 ChrX:45547737..45547897 GAAAGAGCATAGCGGCAAAC ChrX:45547814..45547833 59.99 50
downstream ENSMUSE00000321051 ChrX:45544398..45544556 CCACACAGTTGTCACAGATGC ChrX:45544376..45544396 60.22 52.38
downstream ENSMUSE00000355503 ChrX:45536198..45536335 CGATGTTAAAGGCGAAGACA ChrX:45536191..45536210 58.92 45
downstream ENSMUSE00000321032 ChrX:45535276..45535324 GTTCCAGGCGTTTCTTTCAG ChrX:45535254..45535273 59.85 50
downstream ENSMUSE00000321021 ChrX:45534424..45534526 TGGTCTGATTGAGAGCCACA ChrX:45534413..45534432 60.4 50
downstream ENSMUSE00000321010 ChrX:45531686..45531789 CACACGATTCTTCCCTGTCC ChrX:45531735..45531754 60.51 55
downstream ENSMUSE00000321001 ChrX:45531217..45531313 TCTGTGGCAACAGGCTACTG ChrX:45531200..45531219 60.05 55
downstream ENSMUSE00000331583 ChrX:45525148..45526818 GTCCCCGTAAGTCATCCAGA ChrX:45525187..45525206 59.93 55
downstream ENSMUSE00000701352 ChrX:45525146..45526818 GTCCCCGTAAGTCATCCAGA ChrX:45525187..45525206 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGGACGAGCAACTACTGG ChrX:45561870..45561890 59.87 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGGACGAGCAACTACTGG ChrX:45561870..45561890 59.87 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036985