Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29988
Trapped Gene
Pnpla6 (ENSMUSG00000004565)
Vector Insertion
Chr 8: 3531561 - 3531637
Public Clones D164C11 (ggtc) D164C11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000210013 (Chr8:3531429..3531560 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000210013 (Chr8:3531429..3531560 +)
Downstram Exon
ENSMUSE00000209960 (Chr8:3531638..3531761 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000611157 Chr8:3515384..3515556 No primer for this exon
upstream ENSMUSE00000686582 Chr8:3515425..3515556 No primer for this exon
upstream ENSMUSE00000686581 Chr8:3516510..3516568 No primer for this exon
upstream ENSMUSE00000611156 Chr8:3516681..3516749 No primer for this exon
upstream ENSMUSE00000611155 Chr8:3517077..3517164 No primer for this exon
upstream ENSMUSE00000611154 Chr8:3517325..3517407 No primer for this exon
upstream ENSMUSE00000611153 Chr8:3517558..3517655 No primer for this exon
upstream ENSMUSE00000210002 Chr8:3521275..3521415 No primer for this exon
upstream ENSMUSE00000210011 Chr8:3521508..3521667 No primer for this exon
upstream ENSMUSE00000210001 Chr8:3522101..3522181 No primer for this exon
upstream ENSMUSE00000210003 Chr8:3522277..3522405 No primer for this exon
upstream ENSMUSE00000209956 Chr8:3522588..3522668 No primer for this exon
upstream ENSMUSE00000209974 Chr8:3522759..3522924 No primer for this exon
upstream ENSMUSE00000209985 Chr8:3523258..3523341 No primer for this exon
upstream ENSMUSE00000232852 Chr8:3523758..3523867 No primer for this exon
upstream ENSMUSE00000232846 Chr8:3523999..3524166 No primer for this exon
upstream ENSMUSE00000209968 Chr8:3524252..3524329 No primer for this exon
upstream ENSMUSE00000209983 Chr8:3530962..3531167 No primer for this exon
upstream ENSMUSE00000210013 Chr8:3531429..3531560 No primer for this exon

*** Putative Vector Insertion (Chr 8: 3531561 - 3531637) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209960 Chr8:3531638..3531761 No primer for this exon
downstream ENSMUSE00000209999 Chr8:3532003..3532116 No primer for this exon
downstream ENSMUSE00000209990 Chr8:3532352..3532427 No primer for this exon
downstream ENSMUSE00000210005 Chr8:3534530..3534670 No primer for this exon
downstream ENSMUSE00000209994 Chr8:3534832..3534895 No primer for this exon
downstream ENSMUSE00000442730 Chr8:3535462..3535630 No primer for this exon
downstream ENSMUSE00000209998 Chr8:3535820..3536002 No primer for this exon
downstream ENSMUSE00000209955 Chr8:3536543..3536661 No primer for this exon
downstream ENSMUSE00000209966 Chr8:3536863..3537019 No primer for this exon
downstream ENSMUSE00000209981 Chr8:3537249..3537365 No primer for this exon
downstream ENSMUSE00000542356 Chr8:3537451..3537520 No primer for this exon
downstream ENSMUSE00000542355 Chr8:3537969..3538085 No primer for this exon
downstream ENSMUSE00000210009 Chr8:3541291..3541592 No primer for this exon
downstream ENSMUSE00000232745 Chr8:3542298..3542414 No primer for this exon
downstream ENSMUSE00000209954 Chr8:3542845..3542941 No primer for this exon
downstream ENSMUSE00000209996 Chr8:3543067..3543176 No primer for this exon
downstream ENSMUSE00000542349 Chr8:3543954..3544266 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCTTGTCCTGCTTCACTG Chr8:3531567..3531587 60.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCTTGTCCTGCTTCACTG Chr8:3531567..3531587 60.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004565