Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29989
Trapped Gene
Chd1l (ENSMUSG00000028089)
Vector Insertion
Chr 3: 97409020 - 97414127
Public Clones 3SE305F08 (ggtc) D164A06 (ggtc) 5SE305F08 (ggtc) D164A06 (ggtc)
(egtc)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000400365 (Chr3:97413986..97414126 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCGGACTTACAGCAGTGG Chr3:97413996..97414015 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000400365 (Chr3:97413986..97414126 -)
Downstram Exon
ENSMUSE00000176030 (Chr3:97409021..97409133 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCGGACTTACAGCAGTGG Chr3:97413996..97414015 60.17 55 ATTCTGGCAATGGAAGCACT Chr3:97409044..97409063 59.7 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000400365 Chr3:97413986..97414126 AACCGGACTTACAGCAGTGG Chr3:97413996..97414015 60.17 55
upstream ENSMUSE00000176030 Chr3:97409021..97409133 TTGGCTAGTCCAGTGCTTCC Chr3:97409077..97409096 60.4 55

*** Putative Vector Insertion (Chr 3: 97409020 - 97414127) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176026 Chr3:97407583..97407689 CCCCACCAAGTAAATGAGGA Chr3:97407638..97407657 59.78 50
downstream ENSMUSE00000176019 Chr3:97406932..97407046 ACAGGAAAGACCTGGAGCAA Chr3:97407003..97407022 59.84 50
downstream ENSMUSE00000176028 Chr3:97405945..97405976 TGAGGCATCTTTCAAGCAAA Chr3:97405934..97405953 59.54 40
downstream ENSMUSE00000176018 Chr3:97401615..97401696 AGCAAGAACGCTCCAAGAGA Chr3:97401653..97401672 60.28 50
downstream ENSMUSE00000176017 Chr3:97397931..97398093 GTGAGCAGGAGACGGAAGAC Chr3:97398043..97398062 59.99 60
downstream ENSMUSE00000395030 Chr3:97395128..97395283 TGTGGCTACCTGAGCTTTCA Chr3:97395197..97395216 59.59 50
downstream ENSMUSE00000372360 Chr3:97394477..97394569 ATACGGGTGGTCCACACACT Chr3:97394465..97394484 60.16 55
downstream ENSMUSE00000401268 Chr3:97393829..97393925 TCAGGTGCTCTCCAACTTCA Chr3:97393865..97393884 59.54 50
downstream ENSMUSE00000371388 Chr3:97392163..97392236 ATCCAGCATGTGTGTCATCTG Chr3:97392169..97392189 59.57 47.62
downstream ENSMUSE00000404332 Chr3:97391034..97391144 TAATGGCCAGGTGTCTCTCC Chr3:97391063..97391082 60.07 55
downstream ENSMUSE00000356010 Chr3:97387731..97387845 GTCGCTGTCGACAAAAATGA Chr3:97387768..97387787 59.85 45
downstream ENSMUSE00000340513 Chr3:97386640..97386793 TCAGCCGGATGACTTTAACA Chr3:97386749..97386768 59.27 45
downstream ENSMUSE00000176022 Chr3:97384902..97385100 ATCCAAGCCGAATTTGAGAA Chr3:97385049..97385068 59.65 40
downstream ENSMUSE00000176024 Chr3:97376484..97376632 CCAGCTGCTCAAATGACTTTC Chr3:97376530..97376550 60.01 47.62
downstream ENSMUSE00000446763 Chr3:97374827..97374990 TTCTTCCGTCTGTCCTCCAG Chr3:97374886..97374905 60.38 55
downstream ENSMUSE00000355065 Chr3:97374125..97374327 GAAGGACTGGTAACCGTTGG Chr3:97374269..97374288 59.45 55
downstream ENSMUSE00000403347 Chr3:97373024..97373122 TCCCAGCCAGCTCGTATATT Chr3:97373011..97373030 59.69 50
downstream ENSMUSE00000357495 Chr3:97370682..97370752 CAGATCTTGCCCCTTGTCTC Chr3:97370660..97370679 59.8 55
downstream ENSMUSE00000176014 Chr3:97367380..97367494 TAGGGCTGCCATCTTAATGC Chr3:97367404..97367423 60.2 50
downstream ENSMUSE00000361210 Chr3:97366502..97366610 AGTTGGGATGCCTCGTGTAG Chr3:97366485..97366504 60.13 55
downstream ENSMUSE00000342802 Chr3:97364665..97365010 TGAAAACTGGACCCAATGCT Chr3:97364886..97364905 60.49 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr3:97414056..97414077 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCGGTTAGTAATGGTGGAA Chr3:97414116..97414136 59.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAAAGGTAATCGCCTTGCAG Chr3:97413920..97413940 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACCGGACTTACAGCAGTGG Chr3:97413994..97414014 60.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028089