Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29991
Trapped Gene
Galnt2 (ENSMUSG00000031977)
Vector Insertion
Chr 8: 126755550 - 126819257
Public Clones D163C05 (ggtc) IST12218A8HMR1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000344723 (Chr8:126755294..126755549 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGGCATCGCCTACTACAT Chr8:126755475..126755494 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000344723 (Chr8:126755294..126755549 +)
Downstram Exon
ENSMUSE00000400716 (Chr8:126819258..126819351 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGGCATCGCCTACTACAT Chr8:126755475..126755494 60.12 55 GTCTCCACACCCTGTGCTTT Chr8:126819343..126819362 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344723 Chr8:126755294..126755549 CTGGGCATCGCCTACTACAT Chr8:126755475..126755494 60.12 55

*** Putative Vector Insertion (Chr 8: 126755550 - 126819257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000400716 Chr8:126819258..126819351 GTCTCCACACCCTGTGCTTT Chr8:126819343..126819362 60.16 55
downstream ENSMUSE00000466841 Chr8:126829415..126829568 TCTGTCCATGTGCAGCTTGT Chr8:126829545..126829564 60.47 50
downstream ENSMUSE00000385527 Chr8:126847572..126847670 GACCTGGCTTCATTGTGGAA Chr8:126847649..126847668 61.05 50
downstream ENSMUSE00000284313 Chr8:126847892..126847959 GGTGAGGTGGACTCCTCTTG Chr8:126847920..126847939 59.68 60
downstream ENSMUSE00000284296 Chr8:126848171..126848236 CTCTCCGGTCATTTCTGAGG Chr8:126848236..126848255 59.8 55
downstream ENSMUSE00000284281 Chr8:126851992..126852113 AGCCATCGCTCGTTACACTC Chr8:126852088..126852107 60.43 55
downstream ENSMUSE00000215394 Chr8:126853613..126853700 CACCCTTGAGGTCAGCAGAG Chr8:126853703..126853722 61 60
downstream ENSMUSE00000215395 Chr8:126855909..126855996 TCCCACTTGAACACCAAGTTC Chr8:126855941..126855961 60 47.62
downstream ENSMUSE00000215391 Chr8:126856468..126856571 TGTCGTACTTCCCCAGCTCT Chr8:126856541..126856560 59.87 55
downstream ENSMUSE00000215399 Chr8:126858175..126858301 GAACGTGTAGGGATGCTGCT Chr8:126858275..126858294 60.28 55
downstream ENSMUSE00000215397 Chr8:126860474..126860566 No primer for this exon
downstream ENSMUSE00000284138 Chr8:126861162..126861245 GGTACCACTTGAAGGGCTTG Chr8:126861223..126861242 59.59 55
downstream ENSMUSE00000284126 Chr8:126862343..126862469 TCCAGCGTTGTGACACTCAT Chr8:126862463..126862482 60.32 50
downstream ENSMUSE00000284105 Chr8:126864719..126864838 AACGGTCCACCACAGTAAGG Chr8:126864788..126864807 59.88 55
downstream ENSMUSE00000474401 Chr8:126867203..126869618 TCTGGGATACCCGAGATGAG Chr8:126868689..126868708 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTCCAGGCTGCTTAATCG Chr8:126764587..126764607 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTCGTGACTGGGAAAACC Chr8:126764597..126764617 61.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031977