Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30020
Trapped Gene
Epb4.9 (ENSMUSG00000022099)
Vector Insertion
Chr 14: 71026545 - 71029962
Public Clones D152F09 (ggtc) (ggtc) D152F09 (ggtc) IST13141F11 (tigm) IST10172E1 (tigm)
IST10172F1 (tigm) IST11840B5 (tigm) IST13943G3 (tigm) IST10686D8 (tigm)
IST14652D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000486499 (Chr14:71029824..71029961 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTGGGATTGCTAATGTGA Chr14:71029851..71029870 60.22 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000486499 (Chr14:71029824..71029961 -)
Downstram Exon
ENSMUSE00000686201 (Chr14:71026546..71026865 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTGGGATTGCTAATGTGA Chr14:71029851..71029870 60.22 45 GCGCTTTACGAAGCACAAAT Chr14:71026651..71026670 60.4 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486499 Chr14:71029824..71029961 TGCTGGGATTGCTAATGTGA Chr14:71029851..71029870 60.22 45
upstream ENSMUSE00000487384 Chr14:71026546..71026675 CCTGGAGAAGCTGCCTCTTA Chr14:71026644..71026663 59.71 55
upstream ENSMUSE00000686201 Chr14:71026546..71026865 CCTGGAGAAGCTGCCTCTTA Chr14:71026644..71026663 59.71 55

*** Putative Vector Insertion (Chr 14: 71026545 - 71029962) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000488293 Chr14:71018046..71018215 GCACTTGGAGAGGACAGACG Chr14:71018082..71018101 61.01 60
downstream ENSMUSE00000260068 Chr14:71017762..71017836 GGAGTCTCTGGAGGAGCTGA Chr14:71017770..71017789 59.66 60
downstream ENSMUSE00000123586 Chr14:71017092..71017247 GAGGTCAGGTCGCTCAATGT Chr14:71017136..71017155 60.27 55
downstream ENSMUSE00000123581 Chr14:71015881..71015925 GATTTGGGTGACAGTGAGCA Chr14:71015884..71015903 59.68 50
downstream ENSMUSE00000123588 Chr14:71015421..71015520 GGGGTTGAAGCCTGAGAGAT Chr14:71015449..71015468 60.6 55
downstream ENSMUSE00000123583 Chr14:71015041..71015097 TTGTAGATGGGTGGCTTCTTG Chr14:71015027..71015047 60.12 47.62
downstream ENSMUSE00000260042 Chr14:71014650..71014802 ATGAGGTCCTCGATGAGGTG Chr14:71014732..71014751 60.07 55
downstream ENSMUSE00000260038 Chr14:71013103..71013227 CTTCCGTTTCCTCCATTCTG Chr14:71013183..71013202 59.67 50
downstream ENSMUSE00000123580 Chr14:71012475..71012580 GCAGAGAGCGTGTTTTCCTC Chr14:71012477..71012496 60.14 55
downstream ENSMUSE00000260028 Chr14:71005701..71005765 CCATAGGAAGGAAGCGAAGA Chr14:71005698..71005717 59.41 50
downstream ENSMUSE00000555961 Chr14:71005500..71005548 ATGGGCTGAATTCTGTGGAC Chr14:71005502..71005521 59.93 50
downstream ENSMUSE00000647515 Chr14:71005348..71005355 No primer for this exon
downstream ENSMUSE00000555954 Chr14:71005104..71005169 No primer for this exon
downstream ENSMUSE00000123585 Chr14:71004775..71004855 CCCTTATTGGTCACCACCAG Chr14:71004796..71004815 60.22 55
downstream ENSMUSE00000555964 Chr14:71003480..71004661 GGACCCAGTGCAACCTTTTA Chr14:71003460..71003479 59.97 50
downstream ENSMUSE00000647502 Chr14:71001070..71004661 GGACCCAGTGCAACCTTTTA Chr14:71003460..71003479 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGATGAACTGGACCAGCAA Chr14:71026984..71027004 58.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGATGAACTGGACCAGCAA Chr14:71026984..71027004 58.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022099