Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30023
Trapped Gene
Atad5 (ENSMUSG00000017550)
Vector Insertion
Chr 11: 79946809 - 79947530
Public Clones (sanger) D152C04 (ggtc) IST11012G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000578147 (Chr11:79945967..79946808 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000578147 (Chr11:79945967..79946808 +)
Downstram Exon
ENSMUSE00000578146 (Chr11:79947531..79947689 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676031 Chr11:79902902..79903338 No primer for this exon
upstream ENSMUSE00000578164 Chr11:79902914..79903338 No primer for this exon
upstream ENSMUSE00000283829 Chr11:79907657..79909524 No primer for this exon
upstream ENSMUSE00000108395 Chr11:79911455..79911551 No primer for this exon
upstream ENSMUSE00000108382 Chr11:79913816..79913977 No primer for this exon
upstream ENSMUSE00000578163 Chr11:79915284..79915410 No primer for this exon
upstream ENSMUSE00000578162 Chr11:79916762..79916843 No primer for this exon
upstream ENSMUSE00000578161 Chr11:79919756..79919940 No primer for this exon
upstream ENSMUSE00000578160 Chr11:79921985..79922139 No primer for this exon
upstream ENSMUSE00000578159 Chr11:79922866..79923025 No primer for this exon
upstream ENSMUSE00000578158 Chr11:79923449..79923637 No primer for this exon
upstream ENSMUSE00000578157 Chr11:79924977..79925073 No primer for this exon
upstream ENSMUSE00000578156 Chr11:79926251..79926339 No primer for this exon
upstream ENSMUSE00000676030 Chr11:79926251..79926330 No primer for this exon
upstream ENSMUSE00000578155 Chr11:79926577..79926716 No primer for this exon
upstream ENSMUSE00000578154 Chr11:79927658..79927808 No primer for this exon
upstream ENSMUSE00000578153 Chr11:79932467..79932643 No primer for this exon
upstream ENSMUSE00000578152 Chr11:79932969..79933105 No primer for this exon
upstream ENSMUSE00000578151 Chr11:79934184..79934277 No primer for this exon
upstream ENSMUSE00000578150 Chr11:79937569..79937633 No primer for this exon
upstream ENSMUSE00000578149 Chr11:79940759..79940939 No primer for this exon
upstream ENSMUSE00000578148 Chr11:79944706..79944884 No primer for this exon
upstream ENSMUSE00000578147 Chr11:79945967..79946808 No primer for this exon

*** Putative Vector Insertion (Chr 11: 79946809 - 79947530) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000578146 Chr11:79947531..79947689 No primer for this exon
downstream ENSMUSE00000578145 Chr11:79947795..79949293 No primer for this exon
downstream ENSMUSE00000676029 Chr11:79947795..79949296 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGATTCTAATCGCCTTGC Chr11:79946852..79946872 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTCCGTGACTGGGAAAAC Chr11:79946855..79946875 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017550