Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30036
Trapped Gene
Map3k12 (ENSMUSG00000023050)
Vector Insertion
Chr 15: 102335520 - 102347244
Public Clones D145A11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000483772 (Chr15:102347219..102347243 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000483772 (Chr15:102347219..102347243 -)
Downstram Exon
ENSMUSE00000133215 (Chr15:102335521..102335999 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGCAGACGTACCTCATCAGC Chr15:102335606..102335625 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000483772 Chr15:102347219..102347243 No primer for this exon
upstream ENSMUSE00000133215 Chr15:102335521..102335999 TTTGGGGGCTTTGTGTCTAC Chr15:102335907..102335926 59.97 50

*** Putative Vector Insertion (Chr 15: 102335520 - 102347244) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000133211 Chr15:102334901..102335084 AGTGATGATGTTGGGGTGCT Chr15:102334884..102334903 60.4 50
downstream ENSMUSE00000549005 Chr15:102334546..102334737 TTGAGCGCAGAATTCCATAA Chr15:102334661..102334680 59.4 40
downstream ENSMUSE00000133216 Chr15:102334156..102334314 TGGTGCTCTTGTCACTCAGC Chr15:102334216..102334235 60.19 55
downstream ENSMUSE00000133213 Chr15:102333920..102334078 AGACTGTTGCTTCCCACACC Chr15:102333958..102333977 60.16 55
downstream ENSMUSE00000133212 Chr15:102333068..102333176 GCAGCAAGATCTGTCGGAAT Chr15:102333108..102333127 60.37 50
downstream ENSMUSE00000548993 Chr15:102332746..102332855 CTCTTCTAGGCGGTGCAGAC Chr15:102332756..102332775 60.16 60
downstream ENSMUSE00000133207 Chr15:102332497..102332613 GAGGGCATTCAGTTCCATGT Chr15:102332513..102332532 59.93 50
downstream ENSMUSE00000133210 Chr15:102332265..102332402 GTTTCTGTGGCACGTTCCTT Chr15:102332262..102332281 60.16 50
downstream ENSMUSE00000133209 Chr15:102331532..102332156 CCCACTTAGGGCTGCATCTA Chr15:102332077..102332096 60.23 55
downstream ENSMUSE00000133214 Chr15:102331283..102331353 TTTGACTTGGGGGTAGCTCT Chr15:102331262..102331281 58.79 50
downstream ENSMUSE00000133206 Chr15:102330939..102331200 GTTCATCTGGTCGCTCATCA Chr15:102331030..102331049 59.79 50
downstream ENSMUSE00000507091 Chr15:102328080..102330607 TTTCCGGGATATACCCCTTC Chr15:102328100..102328119 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTGTGGGTAATCGCCTTG Chr15:102338182..102338202 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCCAAAAGAAGAGAGTTGG Chr15:102344244..102344264 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023050