Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30039
Trapped Gene
Ifrg15 (ENSMUSG00000079252)
Vector Insertion
Chr 1: 157883051 - 157888046
Public Clones (sanger) 5SE223B06 (ggtc) D143C02 (ggtc) IST14980H1 (tigm) IST14403E8 (tigm)
IST11632B7 (tigm) IST11591F12 (tigm) IST13266H6 (tigm) IST14540G9 (tigm)
IST11596G9 (tigm) IST14593D1 (tigm) IST14377E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000658985 (Chr1:157882856..157883050 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCGAGACTGTTACCTTCG Chr1:157882873..157882892 59.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000658985 (Chr1:157882856..157883050 +)
Downstram Exon
ENSMUSE00000658978 (Chr1:157888047..157888132 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCGAGACTGTTACCTTCG Chr1:157882873..157882892 59.5 55 AAAACACGGGACAGTCAGGA Chr1:157888117..157888136 60.54 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000658985 Chr1:157882856..157883050 AGCCGAGACTGTTACCTTCG Chr1:157882873..157882892 59.5 55

*** Putative Vector Insertion (Chr 1: 157883051 - 157888046) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000688883 Chr1:157888024..157888132 AAAACACGGGACAGTCAGGA Chr1:157888117..157888136 60.54 50
downstream ENSMUSE00000658978 Chr1:157888047..157888132 AAAACACGGGACAGTCAGGA Chr1:157888117..157888136 60.54 50
downstream ENSMUSE00000718943 Chr1:157888205..157888264 CGATTTCTGTTTGTGCCGTA Chr1:157888265..157888284 59.73 45
downstream ENSMUSE00000462618 Chr1:157898424..157899927 CCTAGGCTACGAACGCAAAG Chr1:157899459..157899478 60.03 55
downstream ENSMUSE00000658977 Chr1:157898424..157900866 CCTAGGCTACGAACGCAAAG Chr1:157899459..157899478 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTAATCGCCTTGCAGCAC Chr1:157886099..157886119 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGAGCGAAGGTTGTAAGC Chr1:157886041..157886061 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079252