Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30049
Trapped Gene
Gpr112 (ENSMUSG00000053852)
Vector Insertion
Chr X: 54230908 - 54233256
Public Clones D138C09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655652 (ChrX:54230764..54230907 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACACCATCGCTCATGTCAAC ChrX:54230826..54230845 59.56 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655652 (ChrX:54230764..54230907 +)
Downstram Exon
ENSMUSE00000655651 (ChrX:54233257..54233529 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACACCATCGCTCATGTCAAC ChrX:54230826..54230845 59.56 50 TGCAGGCAATGCTCTTCTTA ChrX:54233342..54233361 59.71 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700496 ChrX:54125728..54125797 TCAGAGGCTTTGTGGATTGAT ChrX:54125748..54125768 59.69 42.86
upstream ENSMUSE00000700495 ChrX:54147430..54148044 TCAGCCTGACCTACACGATG ChrX:54147487..54147506 59.85 55
upstream ENSMUSE00000700475 ChrX:54147549..54148044 GGTATGGGATGGTGTGAAGG ChrX:54147731..54147750 60.05 55
upstream ENSMUSE00000386381 ChrX:54166320..54172214 CTTTGTGGACCCAGACCAGT ChrX:54171000..54171019 60 55
upstream ENSMUSE00000700494 ChrX:54174602..54174696 AAGGGTCCTCGTTACCACTG ChrX:54174651..54174670 59.06 55
upstream ENSMUSE00000700493 ChrX:54176332..54176396 No primer for this exon
upstream ENSMUSE00000700492 ChrX:54178341..54178384 CCAAAGAAGAGACAGCCATGT ChrX:54178349..54178369 59.34 47.62
upstream ENSMUSE00000700491 ChrX:54179578..54179626 AGGTCAAGGAATGGATGCAA ChrX:54179588..54179607 60.46 45
upstream ENSMUSE00000700490 ChrX:54181324..54181487 TTGTGCCTGTTGGGTTATCA ChrX:54181324..54181343 59.96 45
upstream ENSMUSE00000700489 ChrX:54183180..54183312 AGGAACGCCACAAGAATTTG ChrX:54183293..54183312 60.11 45
upstream ENSMUSE00000700488 ChrX:54185459..54185577 GCAAGTTGCTCCAAGGACTC ChrX:54185515..54185534 60 55
upstream ENSMUSE00000700487 ChrX:54193845..54194061 TGTGACGGAAAAGCAGAGTG ChrX:54194008..54194027 60.03 50
upstream ENSMUSE00000700486 ChrX:54195332..54195494 CTGCGGGTAGACCACAAGTT ChrX:54195423..54195442 60.17 55
upstream ENSMUSE00000700485 ChrX:54202635..54202769 AGGTTCCTCTTGATGGCTTG ChrX:54202705..54202724 59.28 50
upstream ENSMUSE00000700484 ChrX:54207565..54207684 TCCATTCAAAACTTGGCTGA ChrX:54207625..54207644 59.25 40
upstream ENSMUSE00000700482 ChrX:54209136..54209181 GCCTTTTGGGATTTTGACAC ChrX:54209157..54209176 59.41 45
upstream ENSMUSE00000700480 ChrX:54210450..54210553 CCTCACCCACTTTGGAGTCT ChrX:54210529..54210548 59.15 55
upstream ENSMUSE00000700479 ChrX:54211935..54212056 TGTGGGATCTCCTCCATTTT ChrX:54212001..54212020 59.34 45
upstream ENSMUSE00000700478 ChrX:54213099..54213367 ATGCACAGCGTTACTGATGC ChrX:54213141..54213160 59.9 50
upstream ENSMUSE00000623875 ChrX:54216583..54216838 GGATCCTTCCCCCTGAATAA ChrX:54216661..54216680 60.09 50
upstream ENSMUSE00000700477 ChrX:54216760..54216838 CTGAGCCCAACAACTCCATT ChrX:54216819..54216838 60.11 50
upstream ENSMUSE00000623874 ChrX:54221297..54221577 CATCTCCGTGGTGGCTTATT ChrX:54221327..54221346 59.96 50
upstream ENSMUSE00000700476 ChrX:54221297..54221577 CATCTCCGTGGTGGCTTATT ChrX:54221327..54221346 59.96 50
upstream ENSMUSE00000623873 ChrX:54226558..54226659 GAAAGTGTTCGGGAGCAGTG ChrX:54226593..54226612 60.83 55
upstream ENSMUSE00000655652 ChrX:54230764..54230907 ACACCATCGCTCATGTCAAC ChrX:54230826..54230845 59.56 50

*** Putative Vector Insertion (Chr X: 54230908 - 54233256) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655651 ChrX:54233257..54233529 TGCAGGCAATGCTCTTCTTA ChrX:54233342..54233361 59.71 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTACCCAGCATTCCTTCAG ChrX:54230870..54230891 59.74 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTACCCAGCATTCCTTCAG ChrX:54230870..54230891 59.74 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053852