Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30050
Trapped Gene
Pxn (ENSMUSG00000029528)
Vector Insertion
Chr 5: 115956878 - 115993083
Public Clones D117F02 (ggtc) D075A03 (ggtc) (ggtc) D138C03 (ggtc) D082G07 (ggtc)
D062B12 (ggtc) (ggtc) D117F02 (ggtc) D075A03 (ggtc) (ggtc)
D138C03 (ggtc) D056C06 (ggtc) IST12079E9 (tigm) IST11619C4 (tigm)
IST12079E9 (tigm) IST10072D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690307 (Chr5:115956817..115956877 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690307 (Chr5:115956817..115956877 +)
Downstram Exon
ENSMUSE00000690306 (Chr5:115993084..115993096 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650726 Chr5:115956721..115956877 No primer for this exon
upstream ENSMUSE00000690307 Chr5:115956817..115956877 No primer for this exon

*** Putative Vector Insertion (Chr 5: 115956878 - 115993083) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000690306 Chr5:115993084..115993096 No primer for this exon
downstream ENSMUSE00000650725 Chr5:115994352..115994578 TGGTTTCCAGTTGGGTAGGA Chr5:115994454..115994473 60.35 50
downstream ENSMUSE00000267355 Chr5:115994890..115995005 TTGGAGGCACTGGAATTTTT Chr5:115994948..115994967 59.55 40
downstream ENSMUSE00000267348 Chr5:115995381..115995517 CCAGTAACAGCCGGTCAAGT Chr5:115995478..115995497 60.17 55
downstream ENSMUSE00000267342 Chr5:115995613..115995814 CCCCCAAGGGAGTGTTATTT Chr5:115995696..115995715 60.05 50
downstream ENSMUSE00000189819 Chr5:115996822..115996957 ATCTGACAGTGACGCCATGA Chr5:115996954..115996973 60.28 50
downstream ENSMUSE00000650711 Chr5:116001497..116001598 TCCATCCACTCTCTGTTCCA Chr5:116001529..116001548 59.18 50
downstream ENSMUSE00000189826 Chr5:116001860..116002030 GACTGCAGACTCCCCAACAT Chr5:116001957..116001976 60.12 55
downstream ENSMUSE00000189816 Chr5:116002113..116002286 GATGGGTCCGTTGCAGTAGT Chr5:116002283..116002302 60 55
downstream ENSMUSE00000189810 Chr5:116002773..116002854 GGGCACAGAAGAAGTGTTCC Chr5:116002830..116002849 59.7 55
downstream ENSMUSE00000189813 Chr5:116002987..116003135 GGTGTTGAGGGCTGAAATGT Chr5:116003108..116003127 59.97 50
downstream ENSMUSE00000480796 Chr5:116003878..116005988 AGATACCCCGACCTCGTCTT Chr5:116005867..116005886 59.96 55
downstream ENSMUSE00000650708 Chr5:116003878..116004987 GTGAGGTGCTGGCTCTTAGG Chr5:116004429..116004448 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACACTCACGTCCCGTTTGT Chr5:115989881..115989901 59.06 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACACTCACGTCCCGTTTGT Chr5:115989881..115989901 59.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029528