Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30064
Trapped Gene
Herc4 (ENSMUSG00000020064)
Vector Insertion
Chr 10: 62732453 - 62736198
Public Clones D133D04 (ggtc) IST14992H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000100273 (Chr10:62732376..62732452 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000100273 (Chr10:62732376..62732452 +)
Downstram Exon
ENSMUSE00000453488 (Chr10:62736199..62736420 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000612373 Chr10:62706659..62706911 No primer for this exon
upstream ENSMUSE00000612375 Chr10:62708166..62708196 No primer for this exon
upstream ENSMUSE00000612374 Chr10:62708570..62708873 No primer for this exon
upstream ENSMUSE00000271065 Chr10:62726774..62726933 No primer for this exon
upstream ENSMUSE00000100273 Chr10:62732376..62732452 No primer for this exon

*** Putative Vector Insertion (Chr 10: 62732453 - 62736198) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453488 Chr10:62736199..62736420 No primer for this exon
downstream ENSMUSE00000453483 Chr10:62737745..62737836 No primer for this exon
downstream ENSMUSE00000453479 Chr10:62741083..62741213 No primer for this exon
downstream ENSMUSE00000453474 Chr10:62745929..62746089 No primer for this exon
downstream ENSMUSE00000453471 Chr10:62748400..62748476 No primer for this exon
downstream ENSMUSE00000453468 Chr10:62748765..62748889 No primer for this exon
downstream ENSMUSE00000453466 Chr10:62750267..62750326 No primer for this exon
downstream ENSMUSE00000453461 Chr10:62750646..62750757 No primer for this exon
downstream ENSMUSE00000453459 Chr10:62751800..62751989 No primer for this exon
downstream ENSMUSE00000358847 Chr10:62753252..62753424 No primer for this exon
downstream ENSMUSE00000270957 Chr10:62761868..62761987 No primer for this exon
downstream ENSMUSE00000575853 Chr10:62766593..62766616 No primer for this exon
downstream ENSMUSE00000270945 Chr10:62769096..62769194 No primer for this exon
downstream ENSMUSE00000270935 Chr10:62770490..62770657 No primer for this exon
downstream ENSMUSE00000270922 Chr10:62771055..62771198 No primer for this exon
downstream ENSMUSE00000270910 Chr10:62774215..62774381 No primer for this exon
downstream ENSMUSE00000270901 Chr10:62774596..62774662 No primer for this exon
downstream ENSMUSE00000270894 Chr10:62777235..62777317 No primer for this exon
downstream ENSMUSE00000270886 Chr10:62778408..62778591 No primer for this exon
downstream ENSMUSE00000270879 Chr10:62779448..62779550 No primer for this exon
downstream ENSMUSE00000401134 Chr10:62780028..62780622 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTGCTAATCGCCTTGCAG Chr10:62735498..62735518 60.54 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCTGGGGACTGTGAACTT Chr10:62735422..62735442 59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020064