Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30072
Trapped Gene
5730494N06Rik (ENSMUSG00000027341)
Vector Insertion
Chr 2: 132071691 - 132073506
Public Clones D127F07 (ggtc) CMHD-GT_518H12-5S (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682978 (Chr2:132073332..132073505 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTTCCCGGAGACAGTTAG Chr2:132073364..132073383 60.39 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682978 (Chr2:132073332..132073505 -)
Downstram Exon
ENSMUSE00000682980 (Chr2:132071692..132073390 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTTCCCGGAGACAGTTAG Chr2:132073364..132073383 60.39 55 CTTACGGTGACCCGACACTT Chr2:132071906..132071925 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682978 Chr2:132073332..132073505 TGCTTCCCGGAGACAGTTAG Chr2:132073364..132073383 60.39 55
upstream ENSMUSE00000168572 Chr2:132073309..132073518 TGCTTCCCGGAGACAGTTAG Chr2:132073364..132073383 60.39 55
upstream ENSMUSE00000168575 Chr2:132071692..132071810 TCTGTTATGATGCCGTCTCG Chr2:132071777..132071796 59.82 50
upstream ENSMUSE00000682980 Chr2:132071692..132073390 AAGTGTCGGGTCACCGTAAG Chr2:132071928..132071947 60.03 55
upstream ENSMUSE00000720186 Chr2:132071692..132071810 TCTGTTATGATGCCGTCTCG Chr2:132071777..132071796 59.82 50

*** Putative Vector Insertion (Chr 2: 132071691 - 132073506) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000168577 Chr2:132069755..132069877 AAAACAGCACGGTAGCAAGG Chr2:132069795..132069814 60.31 50
downstream ENSMUSE00000254221 Chr2:132065230..132066362 AGGCGAAGGCTAGTCATCAA Chr2:132066191..132066210 59.98 50
downstream ENSMUSE00000682979 Chr2:132065228..132066362 AGGCGAAGGCTAGTCATCAA Chr2:132066191..132066210 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTAACGGAGAACGGGTAATC Chr2:132073450..132073471 59.84 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTATCCGCCACGTCACTTCC Chr2:132073531..132073551 62.91 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027341