Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30076
Trapped Gene
Mllt1 (ENSMUSG00000024212)
Vector Insertion
Chr 17: 57045134 - 57059406
Public Clones D124G10 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000283283 (Chr17:57059323..57059405 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGTGGAGGAGTCGGGCTAT Chr17:57059365..57059384 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000283283 (Chr17:57059323..57059405 -)
Downstram Exon
ENSMUSE00000496859 (Chr17:57045135..57045278 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGTGGAGGAGTCGGGCTAT Chr17:57059365..57059384 60.1 55 TGGGGTTATTGAAGGTGAGC Chr17:57045151..57045170 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416506 Chr17:57074686..57074836 No primer for this exon
upstream ENSMUSE00000333643 Chr17:57066415..57066595 CATCCAGCACTTTGTGGAGA Chr17:57066460..57066479 59.83 50
upstream ENSMUSE00000283283 Chr17:57059323..57059405 AAGTGGAGGAGTCGGGCTAT Chr17:57059365..57059384 60.1 55
upstream ENSMUSE00000496859 Chr17:57045135..57045278 AATAACCCCACCACCGAGTT Chr17:57045163..57045182 60.48 50

*** Putative Vector Insertion (Chr 17: 57045134 - 57059406) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139779 Chr17:57041986..57042111 CGTGGGATGGTTTGTTCTTC Chr17:57041972..57041991 60.35 50
downstream ENSMUSE00000139780 Chr17:57039192..57039719 ACCTTGTGTGGTTTGGAAGC Chr17:57039654..57039673 60.01 50
downstream ENSMUSE00000139789 Chr17:57036803..57036890 CATTAGCTGGGCTTGACTGG Chr17:57036844..57036863 60.79 55
downstream ENSMUSE00000139783 Chr17:57035632..57035740 GGTGTTCTCCTCTCCTGACG Chr17:57035639..57035658 59.83 60
downstream ENSMUSE00000139778 Chr17:57034422..57034521 TCTGCGCTGTTGTCACTCTC Chr17:57034461..57034480 60.34 55
downstream ENSMUSE00000139782 Chr17:57034254..57034325 No primer for this exon
downstream ENSMUSE00000139781 Chr17:57034090..57034161 No primer for this exon
downstream ENSMUSE00000481596 Chr17:57032035..57034013 GGGCCAGTGACGTGTCTATT Chr17:57032150..57032169 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCTCCCCACTTTTAATCG Chr17:57056349..57056369 59.02 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACTTTCGTGACTGGGAAA Chr17:57056342..57056362 61.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024212