Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30077
Trapped Gene
C77370 (ENSMUSG00000046449)
Vector Insertion
Chr X: 101294964 - 101396457
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
D124F10 (ggtc) D036F01 (ggtc) (ggtc) D093C09 (ggtc) (ggtc)
D093C09 (ggtc) IST14346D11 (tigm) IST14959C1 (tigm) IST13606E11 (tigm)
IST13609A6 (tigm) IST14257G2 (tigm) IST14190C7 (tigm) IST14937G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000437005 (ChrX:101395972..101396456 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGGAGCCTCTGAGTTTCG ChrX:101396244..101396263 61.53 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000437005 (ChrX:101395972..101396456 -)
Downstram Exon
ENSMUSE00000696311 (ChrX:101294965..101295020 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGGAGCCTCTGAGTTTCG ChrX:101396244..101396263 61.53 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000437005 ChrX:101395972..101396456 TGTGGAGCCTCTGAGTTTCG ChrX:101396244..101396263 61.53 55
upstream ENSMUSE00000707979 ChrX:101395972..101396524 GCTCTGCCTCCATCTAGTGC ChrX:101396208..101396227 60.13 60
upstream ENSMUSE00000696311 ChrX:101294965..101295020 GCTCTGCAAGCTGAGAACTG ChrX:101294999..101295018 59.06 55

*** Putative Vector Insertion (Chr X: 101294964 - 101396457) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000336800 ChrX:101284220..101284345 GGCTGAGGCAGCAATAACTT ChrX:101284238..101284257 59.48 50
downstream ENSMUSE00000714174 ChrX:101284220..101284345 GGCTGAGGCAGCAATAACTT ChrX:101284238..101284257 59.48 50
downstream ENSMUSE00000380699 ChrX:101279195..101283569 TTTGCTCTGCAGAATGGTTG ChrX:101281112..101281131 59.99 45
downstream ENSMUSE00000622889 ChrX:101278529..101278622 AACCCCAAATGCTGTTTCTG ChrX:101278555..101278574 59.97 45
downstream ENSMUSE00000548481 ChrX:101272774..101283569 CATGCAAAACTTCGCTTTCA ChrX:101279067..101279086 59.99 40
downstream ENSMUSE00000713148 ChrX:101272773..101283569 CATGCAAAACTTCGCTTTCA ChrX:101279067..101279086 59.99 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTAATCGCCTTGCAGCAC ChrX:101345389..101345409 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTAAAACTGGCCAAATGA ChrX:101303480..101303500 60.07 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046449