Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30082
Trapped Gene
C030039L03Rik (ENSMUSG00000057093)
Vector Insertion
Chr 7: 28478628 - 28483671
Public Clones D122D03 (ggtc) D122D03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636154 (Chr7:28478501..28478627 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGATGTGGCTGTTGACTT Chr7:28478516..28478535 59.58 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636154 (Chr7:28478501..28478627 +)
Downstram Exon
ENSMUSE00000636153 (Chr7:28483672..28483770 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGATGTGGCTGTTGACTT Chr7:28478516..28478535 59.58 50 CTCGGCCTGTCTGTTTCTTC Chr7:28483768..28483787 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718014 Chr7:28474359..28474505 GCAGCATAGGGTCGGAAGTA Chr7:28474409..28474428 60.24 55
upstream ENSMUSE00000718066 Chr7:28476234..28476314 No primer for this exon
upstream ENSMUSE00000715549 Chr7:28477501..28477553 GGAAGCCTGAAGAAGAATGG Chr7:28477505..28477524 58.86 50
upstream ENSMUSE00000597851 Chr7:28477521..28477553 No primer for this exon
upstream ENSMUSE00000636154 Chr7:28478501..28478627 AGGGATGTGGCTGTTGACTT Chr7:28478516..28478535 59.58 50

*** Putative Vector Insertion (Chr 7: 28478628 - 28483671) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636153 Chr7:28483672..28483770 CTCGGCCTGTCTGTTTCTTC Chr7:28483768..28483787 59.99 55
downstream ENSMUSE00000507774 Chr7:28487399..28491499 CAAGGGCAGCTTTACCTCTG Chr7:28491257..28491276 60.01 55
downstream ENSMUSE00000712184 Chr7:28487399..28491503 CAAGGGCAGCTTTACCTCTG Chr7:28491257..28491276 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGGGGGATGTGTCCTCTA Chr7:28481647..28481667 59.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGAATGGGGGATGTGTCCT Chr7:28478644..28478664 61.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057093