Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30085
Trapped Gene
Ubac2 (ENSMUSG00000041765)
Vector Insertion
Chr 14: 122307543 - 122372830
Public Clones (ggtc) D121E07 (ggtc) IST14836F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000433896 (Chr14:122307433..122307542 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGTATTCGCTTGGTGTCA Chr14:122307495..122307514 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000433896 (Chr14:122307433..122307542 +)
Downstram Exon
ENSMUSE00000433888 (Chr14:122372831..122372954 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGTATTCGCTTGGTGTCA Chr14:122307495..122307514 59.87 50 TGGAACAAAGAGAGCGAACA Chr14:122372864..122372883 59.57 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000482899 Chr14:122277828..122277996 No primer for this exon
upstream ENSMUSE00000433942 Chr14:122304345..122304472 CATGCTGTCAAGCACGACTT Chr14:122304449..122304468 60.06 50
upstream ENSMUSE00000433902 Chr14:122306513..122306632 GAGGCTGATATGCGGAAGAA Chr14:122306518..122306537 60.32 50
upstream ENSMUSE00000433896 Chr14:122307433..122307542 GCAGTATTCGCTTGGTGTCA Chr14:122307495..122307514 59.87 50

*** Putative Vector Insertion (Chr 14: 122307543 - 122372830) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000433888 Chr14:122372831..122372954 TGGAACAAAGAGAGCGAACA Chr14:122372864..122372883 59.57 45
downstream ENSMUSE00000433877 Chr14:122382490..122382537 CCAGATGTAGGACCCAGAGG Chr14:122382519..122382538 59.53 60
downstream ENSMUSE00000356071 Chr14:122393447..122393692 AGGAGAAGAACTCGGCCATT Chr14:122393534..122393553 60.21 50
downstream ENSMUSE00000226438 Chr14:122408013..122408135 CGGTTCCAATTGATCATTCC Chr14:122408038..122408057 60.13 45
downstream ENSMUSE00000433856 Chr14:122419172..122420256 CGGGCACATCACTGTCATAC Chr14:122419314..122419333 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCAAAAGCCCCTTGGACT Chr14:122367517..122367537 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCAAAAGCCCCTTGGACT Chr14:122367517..122367537 60.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041765