Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30094
Trapped Gene
Abl1 (ENSMUSG00000026842)
Vector Insertion
Chr 2: 31546280 - 31615499
Public Clones (ggtc) D119D11 (ggtc) D119D11 (ggtc) IST11638C12 (tigm) IST14478B5 (tigm)
IST13621F8 (tigm) IST13621F8 (tigm) IST10837F12 (tigm) IST12578A1 (tigm)
IST12858E9 (tigm) IST12040A2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695649 (Chr2:31546219..31546279 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTGCACTTGAAACTTCTCG Chr2:31546247..31546267 59.81 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695649 (Chr2:31546219..31546279 +)
Downstram Exon
ENSMUSE00000352617 (Chr2:31615500..31615635 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTGCACTTGAAACTTCTCG Chr2:31546247..31546267 59.81 47.62 GTAGCAGCTGGAGGACGAAG Chr2:31615631..31615650 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000478509 Chr2:31544833..31545462 ACTTTTGGCATTGCGGTTAC Chr2:31545076..31545095 60 45
upstream ENSMUSE00000695649 Chr2:31546219..31546279 AGCTGCACTTGAAACTTCTCG Chr2:31546247..31546267 59.81 47.62

*** Putative Vector Insertion (Chr 2: 31546280 - 31615499) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000352617 Chr2:31615500..31615635 GTAGCAGCTGGAGGACGAAG Chr2:31615631..31615650 60.16 60
downstream ENSMUSE00000695641 Chr2:31615912..31615975 GGTGTAGGTCCACCTTTGTGA Chr2:31615937..31615957 59.88 52.38
downstream ENSMUSE00000604210 Chr2:31633854..31634027 GAGTTCCATCGAGCTGCTTC Chr2:31633926..31633945 60.1 55
downstream ENSMUSE00000604209 Chr2:31634441..31634736 CAGCAGCATTCCGAGATACA Chr2:31634602..31634621 59.97 50
downstream ENSMUSE00000604208 Chr2:31640027..31640299 GCTGGGTAGTGGAGTGTGGT Chr2:31640130..31640149 60.03 60
downstream ENSMUSE00000604207 Chr2:31645791..31645875 CTGCACCAGGTTAGGGTGTT Chr2:31645871..31645890 60.03 55
downstream ENSMUSE00000604206 Chr2:31646182..31646359 CAGGTAGTCCAGCAGGTTCC Chr2:31646258..31646277 59.72 60
downstream ENSMUSE00000604205 Chr2:31647758..31647942 GTTGTAGGCCAGGCTCTCAG Chr2:31647917..31647936 60.01 60
downstream ENSMUSE00000604204 Chr2:31650062..31650214 GGTAGCAATCTCCCAGAGCA Chr2:31650096..31650115 60.36 55
downstream ENSMUSE00000604203 Chr2:31652493..31652582 TCAAAGGCTTGGTGGATTTC Chr2:31652553..31652572 60.05 45
downstream ENSMUSE00000604202 Chr2:31653083..31653247 CTCTCCTGCAGGTTCTGGTC Chr2:31653184..31653203 59.99 60
downstream ENSMUSE00000346836 Chr2:31655726..31659747 GGACTTGGTAGGCTCTGCTG Chr2:31656024..31656043 60.01 60
downstream ENSMUSE00000604211 Chr2:31655726..31659054 GGACTTGGTAGGCTCTGCTG Chr2:31656024..31656043 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTTCCATATTGGCCTCTT Chr2:31579237..31579257 58.28 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTTCCATATTGGCCTCTT Chr2:31579237..31579257 58.28 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026842