Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30096
Trapped Gene
Rfx1 (ENSMUSG00000031706)
Vector Insertion
Chr 8: 86590948 - 86597629
Public Clones (sanger) D118F11 (ggtc) D118F11 (ggtc) IST14397C7 (tigm) IST10059E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000407950 (Chr8:86590765..86590947 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACGCCAGTCAACAACAAC Chr8:86590800..86590819 60.2 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000407950 (Chr8:86590765..86590947 +)
Downstram Exon
ENSMUSE00000269634 (Chr8:86597630..86597968 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACGCCAGTCAACAACAAC Chr8:86590800..86590819 60.2 50 CTTTGCAGCTCGGTGACATA Chr8:86597834..86597853 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000407950 Chr8:86590765..86590947 CAACGCCAGTCAACAACAAC Chr8:86590800..86590819 60.2 50

*** Putative Vector Insertion (Chr 8: 86590948 - 86597629) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000269634 Chr8:86597630..86597968 CTTTGCAGCTCGGTGACATA Chr8:86597834..86597853 60.01 50
downstream ENSMUSE00000269601 Chr8:86603762..86603871 GGCTGGCTTCTGACACAGTC Chr8:86603806..86603825 61.02 60
downstream ENSMUSE00000269573 Chr8:86604024..86604107 TGGCACCTGAATGTTGGTAA Chr8:86604104..86604123 59.96 45
downstream ENSMUSE00000269550 Chr8:86605014..86605121 GACCTGGCCACTCTTAGTGC Chr8:86605079..86605098 59.87 60
downstream ENSMUSE00000269524 Chr8:86606547..86606660 GGACGCTGTGGACCTGTAGT Chr8:86606637..86606656 60.18 60
downstream ENSMUSE00000269502 Chr8:86607981..86608073 TCTTGAGCAACGTGAACTGG Chr8:86608075..86608094 60.03 50
downstream ENSMUSE00000269483 Chr8:86609472..86609566 ACCTTCCACGTACTGCACCT Chr8:86609540..86609559 59.65 55
downstream ENSMUSE00000372199 Chr8:86611605..86611971 TCTCCGGGTACTGGTAGGTG Chr8:86611636..86611655 59.98 60
downstream ENSMUSE00000212111 Chr8:86614010..86614191 ATGAATACCGAGCGGATGAG Chr8:86614164..86614183 60.06 50
downstream ENSMUSE00000212119 Chr8:86614849..86614968 CGCAGGCCGTAATAGTGGTA Chr8:86614884..86614903 61.03 55
downstream ENSMUSE00000269363 Chr8:86615265..86615377 CAGGAACTGCTGGTACTGCT Chr8:86615379..86615398 58.12 55
downstream ENSMUSE00000269328 Chr8:86616434..86616552 CTCAGCAAAATCAGGCAAGC Chr8:86616468..86616487 61.05 50
downstream ENSMUSE00000212122 Chr8:86616679..86616788 TTACCATGACGTCCACGATG Chr8:86616703..86616722 60.39 50
downstream ENSMUSE00000269268 Chr8:86616873..86617024 TTGGAGAGGAGCACCAGACT Chr8:86616929..86616948 59.99 55
downstream ENSMUSE00000269248 Chr8:86617102..86617199 TCTCCTCAGGGATGTTCACC Chr8:86617188..86617207 60.05 55
downstream ENSMUSE00000581443 Chr8:86618626..86618775 CAAGTGGTTGAGCGATGTGT Chr8:86618688..86618707 59.75 50
downstream ENSMUSE00000581442 Chr8:86618849..86619057 TCCAGTGAGTTCTGCTGCTG Chr8:86618946..86618965 60.33 55
downstream ENSMUSE00000581441 Chr8:86619295..86619448 GTCAGGTCCCGGATTACCAT Chr8:86619321..86619340 60.97 55
downstream ENSMUSE00000269135 Chr8:86619527..86619572 CCAAGGGATTCAGTGAGGTG Chr8:86619563..86619582 60.5 55
downstream ENSMUSE00000269117 Chr8:86619696..86620901 CAAGCGGCACTCACTAATCA Chr8:86620600..86620619 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGCACAGGGTTAGAAGAA Chr8:86593938..86593958 60.63 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGCACAGGGTTAGAAGAA Chr8:86593938..86593958 60.63 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031706