Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30101
Trapped Gene
Def8 (ENSMUSG00000001482)
Vector Insertion
Chr 8: 125971264 - 125971687
Public Clones D117E12 (ggtc) D117F12 (ggtc) D117E12 (ggtc) IST14503C8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678176 (Chr8:125971217..125971263 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678176 (Chr8:125971217..125971263 +)
Downstram Exon
ENSMUSE00000502574 (Chr8:125971688..125971812 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362720 Chr8:125966886..125966951 No primer for this exon
upstream ENSMUSE00000706215 Chr8:125966896..125966951 No primer for this exon
upstream ENSMUSE00000605685 Chr8:125966905..125966951 No primer for this exon
upstream ENSMUSE00000678175 Chr8:125967208..125967345 No primer for this exon
upstream ENSMUSE00000712640 Chr8:125969998..125970084 No primer for this exon
upstream ENSMUSE00000722052 Chr8:125969998..125970084 No primer for this exon
upstream ENSMUSE00000678199 Chr8:125970059..125970084 No primer for this exon
upstream ENSMUSE00000678176 Chr8:125971217..125971263 No primer for this exon

*** Putative Vector Insertion (Chr 8: 125971264 - 125971687) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487010 Chr8:125971688..125971812 No primer for this exon
downstream ENSMUSE00000502574 Chr8:125971688..125971812 No primer for this exon
downstream ENSMUSE00000720527 Chr8:125971688..125971812 No primer for this exon
downstream ENSMUSE00000287889 Chr8:125973201..125973298 No primer for this exon
downstream ENSMUSE00000215300 Chr8:125976645..125976794 No primer for this exon
downstream ENSMUSE00000215307 Chr8:125978129..125978270 No primer for this exon
downstream ENSMUSE00000215306 Chr8:125979314..125979478 No primer for this exon
downstream ENSMUSE00000215314 Chr8:125980306..125980433 No primer for this exon
downstream ENSMUSE00000215311 Chr8:125980571..125980684 No primer for this exon
downstream ENSMUSE00000215313 Chr8:125982251..125982331 No primer for this exon
downstream ENSMUSE00000287705 Chr8:125983417..125983557 No primer for this exon
downstream ENSMUSE00000287678 Chr8:125983717..125983826 No primer for this exon
downstream ENSMUSE00000678174 Chr8:125983717..125984415 No primer for this exon
downstream ENSMUSE00000401218 Chr8:125985364..125987162 No primer for this exon
downstream ENSMUSE00000434262 Chr8:125985364..125987161 No primer for this exon
downstream ENSMUSE00000605684 Chr8:125985364..125987170 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGATCCAGTTCCAAGAGG Chr8:125971245..125971266 60.06 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACTAGACTGGAGCCGTGA Chr8:125971300..125971320 59.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001482