Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30125
Trapped Gene
Rfx5 (ENSMUSG00000005774)
Vector Insertion
Chr 3: 94758807 - 94758936
Public Clones D110A12 (ggtc) D110A12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672507 (Chr3:94758685..94758806 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672507 (Chr3:94758685..94758806 +)
Downstram Exon
ENSMUSE00000410388 (Chr3:94758937..94759068 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672515 Chr3:94757997..94758114 No primer for this exon
upstream ENSMUSE00000566417 Chr3:94758092..94758173 No primer for this exon
upstream ENSMUSE00000419668 Chr3:94758148..94758173 No primer for this exon
upstream ENSMUSE00000566416 Chr3:94758685..94758711 No primer for this exon
upstream ENSMUSE00000672507 Chr3:94758685..94758806 No primer for this exon
upstream ENSMUSE00000672510 Chr3:94758685..94758799 No primer for this exon
upstream ENSMUSE00000672514 Chr3:94758685..94758803 No primer for this exon

*** Putative Vector Insertion (Chr 3: 94758807 - 94758936) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000410388 Chr3:94758937..94759068 No primer for this exon
downstream ENSMUSE00000712144 Chr3:94758937..94759068 No primer for this exon
downstream ENSMUSE00000672513 Chr3:94758943..94759068 No primer for this exon
downstream ENSMUSE00000176576 Chr3:94759274..94759307 No primer for this exon
downstream ENSMUSE00000176569 Chr3:94759668..94759750 No primer for this exon
downstream ENSMUSE00000176567 Chr3:94760194..94760313 No primer for this exon
downstream ENSMUSE00000176574 Chr3:94760409..94760528 No primer for this exon
downstream ENSMUSE00000176559 Chr3:94760643..94760724 No primer for this exon
downstream ENSMUSE00000176565 Chr3:94761019..94761220 No primer for this exon
downstream ENSMUSE00000255777 Chr3:94761704..94761807 No primer for this exon
downstream ENSMUSE00000672505 Chr3:94761704..94765271 No primer for this exon
downstream ENSMUSE00000255772 Chr3:94762172..94765483 No primer for this exon
downstream ENSMUSE00000566411 Chr3:94762172..94763501 No primer for this exon
downstream ENSMUSE00000672506 Chr3:94762172..94763528 No primer for this exon
downstream ENSMUSE00000672511 Chr3:94762172..94763616 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGAAGGCAAGTGGTGTGG Chr3:94758794..94758814 60.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGAAGGCAAGTGGTGTGG Chr3:94758794..94758814 60.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005774