Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30127
Trapped Gene
Ptdss2 (ENSMUSG00000025495)
Vector Insertion
Chr 7: 148329075 - 148332979
Public Clones D109H01 (ggtc) D109H01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151160 (Chr7:148328992..148329074 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCTAAAGACGGGCCATTT Chr7:148329039..148329058 60.1 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151160 (Chr7:148328992..148329074 +)
Downstram Exon
ENSMUSE00000151153 (Chr7:148332980..148333047 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCTAAAGACGGGCCATTT Chr7:148329039..148329058 60.1 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000341756 Chr7:148317185..148317416 ACGACGATGGCACTAACACC Chr7:148317389..148317408 60.99 55
upstream ENSMUSE00000151152 Chr7:148321208..148321309 CTGGGCTACGTGACTCTCCT Chr7:148321251..148321270 59.47 60
upstream ENSMUSE00000151160 Chr7:148328992..148329074 AAGCTAAAGACGGGCCATTT Chr7:148329039..148329058 60.1 45

*** Putative Vector Insertion (Chr 7: 148329075 - 148332979) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151153 Chr7:148332980..148333047 No primer for this exon
downstream ENSMUSE00000151158 Chr7:148337549..148337683 CGTAGTCCCTCTCTGGCAAT Chr7:148337627..148337646 59.31 55
downstream ENSMUSE00000151150 Chr7:148338091..148338141 TACCAGCCAATGAAGTGTGC Chr7:148338137..148338156 59.72 50
downstream ENSMUSE00000151156 Chr7:148338674..148338787 ATCCACCAGTCACGGATCAT Chr7:148338702..148338721 60.21 50
downstream ENSMUSE00000151154 Chr7:148338874..148338992 GAGGGTCTTCATGCCACAGT Chr7:148338936..148338955 60.12 55
downstream ENSMUSE00000151155 Chr7:148340252..148340366 GCTTCCACTCAAAGCGTACC Chr7:148340319..148340338 59.88 55
downstream ENSMUSE00000151149 Chr7:148340456..148340601 CACGTTCACGAAGAAGACCA Chr7:148340560..148340579 59.87 50
downstream ENSMUSE00000151151 Chr7:148340710..148340895 GCAGTGACAGGGTGAGTGTG Chr7:148340822..148340841 60.37 60
downstream ENSMUSE00000631812 Chr7:148341233..148342053 CCAAGATACCTCCCCTAGCC Chr7:148341727..148341746 59.92 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATGACGTCAGGGTTTCTG Chr7:148329049..148329069 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATGACGTCAGGGTTTCTG Chr7:148329049..148329069 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025495