Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30137
Trapped Gene
Mospd3 (ENSMUSG00000037221)
Vector Insertion
Chr 5: 138037883 - 138038544
Public Clones D105E11 (ggtc) D105E11 (ggtc) IST14793A5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306973 (Chr5:138038379..138038543 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCTGCTCCTACCACTGC Chr5:138038457..138038476 60.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306973 (Chr5:138038379..138038543 -)
Downstram Exon
ENSMUSE00000686293 (Chr5:138037884..138038281 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCTGCTCCTACCACTGC Chr5:138038457..138038476 60.01 60 AGGAGCAAGGTGCAAACATC Chr5:138038143..138038162 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387892 Chr5:138041970..138042272 AAGAGCAGAGTCCGTCAGGA Chr5:138042083..138042102 60.13 55
upstream ENSMUSE00000343999 Chr5:138041499..138041771 TAGTATTCAGGGCGGACCAG Chr5:138041563..138041582 60.09 55
upstream ENSMUSE00000686289 Chr5:138041499..138041936 TAGTATTCAGGGCGGACCAG Chr5:138041563..138041582 60.09 55
upstream ENSMUSE00000306984 Chr5:138041205..138041280 GTGAAGCCTCAGTCCTGCAT Chr5:138041211..138041230 60.42 55
upstream ENSMUSE00000306979 Chr5:138040822..138041051 GGACGAGTGGTTGGAAGAAA Chr5:138040947..138040966 60.09 50
upstream ENSMUSE00000306973 Chr5:138038379..138038543 CTTCCTGCTCCTACCACTGC Chr5:138038457..138038476 60.01 60
upstream ENSMUSE00000686293 Chr5:138037884..138038281 GATGTTTGCACCTTGCTCCT Chr5:138038165..138038184 60.26 50

*** Putative Vector Insertion (Chr 5: 138037883 - 138038544) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000379307 Chr5:138037873..138038281 AGGAGCAAGGTGCAAACATC Chr5:138038143..138038162 60.26 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATCTCCCTCCTTTTGCAG Chr5:138038542..138038562 60.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATCTCCCTCCTTTTGCAG Chr5:138038542..138038562 60.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037221