Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30147
Trapped Gene
Golga3 (ENSMUSG00000029502)
Vector Insertion
Chr 5: 110605942 - 110610621
Public Clones (sanger) D103C05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000445555 (Chr5:110605720..110605941 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGTCCGGAGATCCATACC Chr5:110605755..110605774 59.89 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000445555 (Chr5:110605720..110605941 +)
Downstram Exon
ENSMUSE00000409750 (Chr5:110610622..110610932 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGTCCGGAGATCCATACC Chr5:110605755..110605774 59.89 55 ATCCTGTTTGGCTGATGCTC Chr5:110610826..110610845 60.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445555 Chr5:110605720..110605941 TCTGTCCGGAGATCCATACC Chr5:110605755..110605774 59.89 55

*** Putative Vector Insertion (Chr 5: 110605942 - 110610621) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000409750 Chr5:110610622..110610932 ATCCTGTTTGGCTGATGCTC Chr5:110610826..110610845 60.23 50
downstream ENSMUSE00000713219 Chr5:110610622..110610932 ATCCTGTTTGGCTGATGCTC Chr5:110610826..110610845 60.23 50
downstream ENSMUSE00000540529 Chr5:110613357..110613626 CCACACCTGTAGAGGCATCA Chr5:110613515..110613534 59.7 55
downstream ENSMUSE00000691944 Chr5:110613357..110613506 GGGATCAAGGGACAACTGAA Chr5:110613475..110613494 59.9 50
downstream ENSMUSE00000299106 Chr5:110614805..110614917 CTCCTTTTCCAAAGGCAATG Chr5:110614842..110614861 59.68 45
downstream ENSMUSE00000299102 Chr5:110616360..110617006 TCAGCCAGAGACCGAATCTT Chr5:110616586..110616605 59.95 50
downstream ENSMUSE00000299095 Chr5:110617682..110617793 ATGACAAAGCCTCCACCTGT Chr5:110617782..110617801 59.58 50
downstream ENSMUSE00000299090 Chr5:110618625..110618931 GCTCCTCTGCCACTTGTAGG Chr5:110618868..110618887 60.01 60
downstream ENSMUSE00000299085 Chr5:110621926..110622128 TCTGTAGCGCTGTCATCTGC Chr5:110621964..110621983 60.32 55
downstream ENSMUSE00000299078 Chr5:110622638..110622775 AGCTGATGCGATAGGGACAC Chr5:110622711..110622730 60.25 55
downstream ENSMUSE00000299072 Chr5:110630850..110631011 TAACTGCTCCCGTTCACCTT Chr5:110630966..110630985 59.73 50
downstream ENSMUSE00000189582 Chr5:110631588..110631956 CTCTTGGCCGATTGTAGAGC Chr5:110631850..110631869 59.98 55
downstream ENSMUSE00000189585 Chr5:110632739..110632816 TTTCTCAACGTGGCTGTCTC Chr5:110632779..110632798 59.01 50
downstream ENSMUSE00000189595 Chr5:110633799..110634062 CCCTGCAGCTTGATTAGCTC Chr5:110633929..110633948 60.12 55
downstream ENSMUSE00000189600 Chr5:110634796..110634890 GTCTCATTGGCCTCGGTAAG Chr5:110634851..110634870 59.69 55
downstream ENSMUSE00000189592 Chr5:110636575..110636791 GCCTCCTTAGAAGCCAGAGC Chr5:110636727..110636746 60.62 60
downstream ENSMUSE00000189586 Chr5:110637459..110637602 CACCTCCAGAGCACGAATCT Chr5:110637485..110637504 60.41 55
downstream ENSMUSE00000189597 Chr5:110638794..110638991 CCCTCTTGGCTAGTGCAGTC Chr5:110638965..110638984 60.01 60
downstream ENSMUSE00000299028 Chr5:110641250..110641366 CTCCTCCTCTTTGCGCTGTA Chr5:110641285..110641304 60.67 55
downstream ENSMUSE00000299024 Chr5:110645853..110645992 TTCTTTGGCCTGCAATTCTT Chr5:110645954..110645973 59.82 40
downstream ENSMUSE00000189591 Chr5:110646830..110646962 GCCAGCTCAGTCTGGAATTG Chr5:110646886..110646905 60.94 55
downstream ENSMUSE00000189596 Chr5:110647113..110647235 TGTGTCCCCTCCAGTTCTTT Chr5:110647225..110647244 59.55 50
downstream ENSMUSE00000189588 Chr5:110649801..110649962 ATCCAGCTTGAGCTGTTGGT Chr5:110649944..110649963 59.87 50
downstream ENSMUSE00000189601 Chr5:110650643..110650806 GGACAGGGCAATCTGGTATC Chr5:110650718..110650737 59.37 55
downstream ENSMUSE00000356242 Chr5:110651927..110652172 No primer for this exon
downstream ENSMUSE00000691943 Chr5:110651927..110655489 AGAGTCCTCTGAACCGCAAA Chr5:110654370..110654389 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATAATCGCCTTGCAGCAC Chr5:110608990..110609010 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGACGTGACTGGGAAAAC Chr5:110608988..110609008 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029502