Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30158
Trapped Gene
Stk38 (ENSMUSG00000024006)
Vector Insertion
Chr 17: 29121021 - 29125207
Public Clones D098B03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137194 (Chr17:29125123..29125206 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGAAAATCCTGCGCAAAG Chr17:29125146..29125165 60.21 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137194 (Chr17:29125123..29125206 -)
Downstram Exon
ENSMUSE00000137186 (Chr17:29121022..29121145 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGAAAATCCTGCGCAAAG Chr17:29125146..29125165 60.21 40 CACAAACTGTCTGCCTCCAC Chr17:29121071..29121090 59.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000431121 Chr17:29144656..29144882 GCAGTTGGGGTTCTTCCTTT Chr17:29144795..29144814 60.48 50
upstream ENSMUSE00000238312 Chr17:29136954..29137086 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000710202 Chr17:29136954..29137089 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000711234 Chr17:29136954..29137086 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000238301 Chr17:29129362..29129413 GAAGGCCTGAAAGACGAAGA Chr17:29129363..29129382 59.55 50
upstream ENSMUSE00000137178 Chr17:29128243..29128365 AGAACAAGGCTTGGACTGGA Chr17:29128289..29128308 59.84 50
upstream ENSMUSE00000137194 Chr17:29125123..29125206 AATGAAAATCCTGCGCAAAG Chr17:29125146..29125165 60.21 40
upstream ENSMUSE00000137186 Chr17:29121022..29121145 GCGGAGCGTGACATTCTAGT Chr17:29121111..29121130 60.43 55

*** Putative Vector Insertion (Chr 17: 29121021 - 29125207) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137185 Chr17:29118977..29119131 TGCTGTCCAAGAGAAGGTTG Chr17:29118957..29118976 59.01 50
downstream ENSMUSE00000549113 Chr17:29117330..29117467 CCTCATGGCACAGCAAGTAA Chr17:29117383..29117402 59.86 50
downstream ENSMUSE00000137179 Chr17:29116148..29116250 AAAGGCCAAAGTCGGAAAGT Chr17:29116198..29116217 60.11 45
downstream ENSMUSE00000137183 Chr17:29114485..29114546 GCTGGCGTCTGTTTCTTTTC Chr17:29114465..29114484 60 50
downstream ENSMUSE00000137192 Chr17:29112764..29112881 TGTAACCCGTCTGCATGAAC Chr17:29112796..29112815 59.57 50
downstream ENSMUSE00000137180 Chr17:29111491..29111614 ATGTCTCTTGTGGGGTCTCG Chr17:29111554..29111573 60.11 55
downstream ENSMUSE00000238116 Chr17:29111227..29111322 AGGGGCTCCGATTCTATGTT Chr17:29111264..29111283 59.92 50
downstream ENSMUSE00000137176 Chr17:29109990..29110084 No primer for this exon
downstream ENSMUSE00000717891 Chr17:29109182..29109621 AGGCCCTATTTTGCTGCTTT Chr17:29109464..29109483 60.22 45
downstream ENSMUSE00000408447 Chr17:29107830..29109621 TAGGCAGTGTGTGCCTCAAG Chr17:29108677..29108696 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTTGGCAGTGTGAACTTG Chr17:29122233..29122253 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGCAATGAAAACGTGACTG Chr17:29122148..29122168 59.76 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024006