Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30161
Trapped Gene
Zbtb26 (ENSMUSG00000050714)
Vector Insertion
Chr 2: 37287689 - 37292520
Public Clones D097F05 (ggtc) IST10722H11 (tigm) IST14559H7 (tigm) IST12705F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662611 (Chr2:37290538..37292519 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATGATTCCCGAGAGGTGA Chr2:37292299..37292318 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662611 (Chr2:37290538..37292519 -)
Downstram Exon
ENSMUSE00000452064 (Chr2:37287690..37292519 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATGATTCCCGAGAGGTGA Chr2:37292299..37292318 60.01 50 CCTGCTTGGAGGCTTTGTAG Chr2:37291064..37291083 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662612 Chr2:37298576..37298640 GATGTAGATGGCGACCTTCC Chr2:37298586..37298605 59.51 55
upstream ENSMUSE00000567438 Chr2:37298207..37298641 GTCTAGGCCCCCAGACTTTT Chr2:37298442..37298461 59.58 55
upstream ENSMUSE00000662611 Chr2:37290538..37292519 GAATGATTCCCGAGAGGTGA Chr2:37292299..37292318 60.01 50
upstream ENSMUSE00000452064 Chr2:37287690..37292519 GAATGATTCCCGAGAGGTGA Chr2:37292299..37292318 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACTGGTTTGGCTATCAAGG Chr2:37289472..37289493 60.12 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGAACGTGACTGGGAAAA Chr2:37289455..37289475 59.15 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050714