Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30171
Trapped Gene
Myo5c (ENSMUSG00000033590)
Vector Insertion
Chr 9: 75079983 - 75089451
Public Clones D094A11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583940 (Chr9:75079821..75079982 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTCGGGAAAACTTCTGCAC Chr9:75079867..75079886 59.33 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583940 (Chr9:75079821..75079982 +)
Downstram Exon
ENSMUSE00000695775 (Chr9:75089452..75089471 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTCGGGAAAACTTCTGCAC Chr9:75079867..75079886 59.33 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583940 Chr9:75079821..75079982 ACTCGGGAAAACTTCTGCAC Chr9:75079867..75079886 59.33 50

*** Putative Vector Insertion (Chr 9: 75079983 - 75089451) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000695775 Chr9:75089452..75089471 No primer for this exon
downstream ENSMUSE00000695773 Chr9:75090565..75090679 GATTTCAGCCGACTTCCAAA Chr9:75090625..75090644 60.19 45
downstream ENSMUSE00000426116 Chr9:75090569..75090679 GATTTCAGCCGACTTCCAAA Chr9:75090625..75090644 60.19 45
downstream ENSMUSE00000386734 Chr9:75092777..75092942 GGCTCATGGAGGTAGCTGAG Chr9:75092883..75092902 59.97 60
downstream ENSMUSE00000531815 Chr9:75093945..75094089 TGATGGCATCCCCGTATATT Chr9:75094007..75094026 60 45
downstream ENSMUSE00000402794 Chr9:75097540..75097696 GCTGACGGTAGCGAAGTACC Chr9:75097639..75097658 59.9 60
downstream ENSMUSE00000531814 Chr9:75098180..75098323 TATTTCCCAAACCGACTGCT Chr9:75098238..75098257 59.57 45
downstream ENSMUSE00000277614 Chr9:75099248..75099329 GGATGCACAAAGCTGGTAGA Chr9:75099298..75099317 58.88 50
downstream ENSMUSE00000425684 Chr9:75100331..75100438 GTTGAACTCTTCCGCACTCC Chr9:75100353..75100372 59.85 55
downstream ENSMUSE00000277562 Chr9:75103638..75103744 TGACTGAAGACCTCTCGTTGC Chr9:75103744..75103764 60.58 52.38
downstream ENSMUSE00000277538 Chr9:75105766..75106031 TTTGCTCGACAATGAAGTCG Chr9:75105970..75105989 59.99 45
downstream ENSMUSE00000277514 Chr9:75110015..75110096 No primer for this exon
downstream ENSMUSE00000277496 Chr9:75110792..75110932 CAAGCATTCTTCATCCAGCA Chr9:75110935..75110954 59.95 45
downstream ENSMUSE00000277438 Chr9:75113875..75114000 TTTGAAGCCAGTTTTCATCG Chr9:75113911..75113930 58.89 40
downstream ENSMUSE00000277419 Chr9:75114832..75114915 CAGGAACCCTTCACATTGGT Chr9:75114861..75114880 59.82 50
downstream ENSMUSE00000277398 Chr9:75117328..75117462 AGAAGACGGAACAGGGCTTT Chr9:75117378..75117397 60.25 50
downstream ENSMUSE00000277379 Chr9:75118076..75118173 TTGATGCAACGGACGTAGTG Chr9:75118149..75118168 60.72 50
downstream ENSMUSE00000277354 Chr9:75119350..75119436 CAATCCGCTTGGAGTCAAAC Chr9:75119372..75119391 60.64 50
downstream ENSMUSE00000277335 Chr9:75120652..75120763 ATGAGGATGCCATAGCGACT Chr9:75120696..75120715 59.68 50
downstream ENSMUSE00000425616 Chr9:75121316..75121527 TCCAGGCGGAGTTTCTCTAA Chr9:75121401..75121420 59.95 50
downstream ENSMUSE00000277290 Chr9:75123278..75123443 CGGATCAGCTGGTACAGGTT Chr9:75123382..75123401 60.13 55
downstream ENSMUSE00000277261 Chr9:75123709..75123855 GCTGGACCCTGTAAGTCAGC Chr9:75123832..75123851 59.87 60
downstream ENSMUSE00000277232 Chr9:75124739..75124903 TAGCTGCCTTTTCCAGCTCT Chr9:75124850..75124869 59.36 50
downstream ENSMUSE00000713866 Chr9:75126032..75126125 TGTGCTTCTGCAGCTTTGAC Chr9:75126059..75126078 60.33 50
downstream ENSMUSE00000718767 Chr9:75126032..75126125 TGTGCTTCTGCAGCTTTGAC Chr9:75126059..75126078 60.33 50
downstream ENSMUSE00000583939 Chr9:75127143..75127206 CCTGGTGAGCTTGTCCATTT Chr9:75127168..75127187 60.11 50
downstream ENSMUSE00000695770 Chr9:75127143..75127206 CCTGGTGAGCTTGTCCATTT Chr9:75127168..75127187 60.11 50
downstream ENSMUSE00000531813 Chr9:75129643..75129823 TCTCGTCCTTGAGGGCTTTA Chr9:75129737..75129756 59.95 50
downstream ENSMUSE00000695769 Chr9:75129643..75129823 TCTCGTCCTTGAGGGCTTTA Chr9:75129737..75129756 59.95 50
downstream ENSMUSE00000531812 Chr9:75131700..75131793 CTCTCATCTCCCGTTTCTGTG Chr9:75131795..75131815 59.85 52.38
downstream ENSMUSE00000695768 Chr9:75131700..75131793 CTCTCATCTCCCGTTTCTGTG Chr9:75131795..75131815 59.85 52.38
downstream ENSMUSE00000531811 Chr9:75131954..75132017 CTGCTTGGTGACCTCTGACA Chr9:75131982..75132001 60.02 55
downstream ENSMUSE00000695766 Chr9:75131954..75132017 CTGCTTGGTGACCTCTGACA Chr9:75131982..75132001 60.02 55
downstream ENSMUSE00000531810 Chr9:75132740..75132820 TCCTTCGTAGGCAAACCAAA Chr9:75132806..75132825 60.61 45
downstream ENSMUSE00000695765 Chr9:75132740..75132820 TCCTTCGTAGGCAAACCAAA Chr9:75132806..75132825 60.61 45
downstream ENSMUSE00000531809 Chr9:75134218..75134398 CTCAGGTGCACGACTTTGAA Chr9:75134304..75134323 60.03 50
downstream ENSMUSE00000695763 Chr9:75134218..75134398 CTCAGGTGCACGACTTTGAA Chr9:75134304..75134323 60.03 50
downstream ENSMUSE00000531808 Chr9:75135856..75135949 TCCAGCTCTGAAATCTGCTG Chr9:75135896..75135915 59.27 50
downstream ENSMUSE00000695761 Chr9:75135856..75135949 TCCAGCTCTGAAATCTGCTG Chr9:75135896..75135915 59.27 50
downstream ENSMUSE00000531807 Chr9:75136700..75136763 CTCTTCTCGGATTCGGTTCA Chr9:75136749..75136768 60.33 50
downstream ENSMUSE00000695759 Chr9:75136700..75136763 CTCTTCTCGGATTCGGTTCA Chr9:75136749..75136768 60.33 50
downstream ENSMUSE00000531806 Chr9:75136866..75137034 TTTGGGAACTTGATGGCTTC Chr9:75136961..75136980 60.05 45
downstream ENSMUSE00000695757 Chr9:75136866..75137034 TTTGGGAACTTGATGGCTTC Chr9:75136961..75136980 60.05 45
downstream ENSMUSE00000531805 Chr9:75138656..75138743 No primer for this exon
downstream ENSMUSE00000695756 Chr9:75138656..75138743 No primer for this exon
downstream ENSMUSE00000531804 Chr9:75139961..75140059 TGAATGAGCTTCCCCTCATC Chr9:75140048..75140067 60.16 50
downstream ENSMUSE00000695754 Chr9:75139961..75140059 TGAATGAGCTTCCCCTCATC Chr9:75140048..75140067 60.16 50
downstream ENSMUSE00000531803 Chr9:75141733..75141887 GGATCATGTTCACCACCACA Chr9:75141771..75141790 60.23 50
downstream ENSMUSE00000695753 Chr9:75141733..75141887 GGATCATGTTCACCACCACA Chr9:75141771..75141790 60.23 50
downstream ENSMUSE00000531802 Chr9:75142969..75143058 TGTTGGAAAGCCAGAAGGAC Chr9:75143017..75143036 60.23 50
downstream ENSMUSE00000695751 Chr9:75142969..75143058 TGTTGGAAAGCCAGAAGGAC Chr9:75143017..75143036 60.23 50
downstream ENSMUSE00000531801 Chr9:75143817..75143967 ATCCGTATGGCCACATCACT Chr9:75143920..75143939 60.23 50
downstream ENSMUSE00000695749 Chr9:75143817..75143967 ATCCGTATGGCCACATCACT Chr9:75143920..75143939 60.23 50
downstream ENSMUSE00000531800 Chr9:75145211..75145493 CGTCATGGTGTAGGCATCTG Chr9:75145323..75145342 60.14 55
downstream ENSMUSE00000695748 Chr9:75145211..75145493 CGTCATGGTGTAGGCATCTG Chr9:75145323..75145342 60.14 55
downstream ENSMUSE00000531799 Chr9:75148613..75148787 CTTGGCATCACTGTCTGTGG Chr9:75148751..75148770 60.31 55
downstream ENSMUSE00000695747 Chr9:75148613..75148787 CTTGGCATCACTGTCTGTGG Chr9:75148751..75148770 60.31 55
downstream ENSMUSE00000531798 Chr9:75149211..75149291 GTACTTTGCGGACGAAGGAT Chr9:75149292..75149311 59.2 50
downstream ENSMUSE00000695746 Chr9:75149211..75149291 GTACTTTGCGGACGAAGGAT Chr9:75149292..75149311 59.2 50
downstream ENSMUSE00000583938 Chr9:75151737..75153258 TTTGGAAAGCCATCATGTCA Chr9:75153199..75153218 60.05 40
downstream ENSMUSE00000695742 Chr9:75151737..75153258 TTTGGAAAGCCATCATGTCA Chr9:75153199..75153218 60.05 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATACCCTGCTAGGCAGCTTG Chr9:75082982..75083002 59.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATACCCTGCTAGGCAGCTTG Chr9:75082982..75083002 59.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033590