Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30191
Trapped Gene
Ikzf1 (ENSMUSG00000018654)
Vector Insertion
Chr 11: 11661428 - 11668717
Public Clones D085C04 (ggtc) IST14052C2 (tigm) IST14728A4 (tigm) IST10223H10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681154 (Chr11:11661222..11661427 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681154 (Chr11:11661222..11661427 +)
Downstram Exon
ENSMUSE00000681161 (Chr11:11668718..11668723 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444681 Chr11:11585928..11586471 No primer for this exon
upstream ENSMUSE00000476147 Chr11:11586216..11586471 No primer for this exon
upstream ENSMUSE00000655495 Chr11:11586232..11586471 No primer for this exon
upstream ENSMUSE00000466163 Chr11:11590335..11590392 No primer for this exon
upstream ENSMUSE00000401261 Chr11:11600208..11600261 No primer for this exon
upstream ENSMUSE00000485298 Chr11:11600208..11600261 No primer for this exon
upstream ENSMUSE00000714164 Chr11:11600208..11600261 No primer for this exon
upstream ENSMUSE00000330378 Chr11:11607788..11607907 No primer for this exon
upstream ENSMUSE00000477299 Chr11:11640953..11641012 No primer for this exon
upstream ENSMUSE00000681163 Chr11:11640953..11640998 No primer for this exon
upstream ENSMUSE00000681160 Chr11:11640956..11641012 No primer for this exon
upstream ENSMUSE00000330373 Chr11:11648314..11648574 No primer for this exon
upstream ENSMUSE00000655504 Chr11:11654010..11654177 No primer for this exon
upstream ENSMUSE00000681162 Chr11:11655065..11655072 No primer for this exon
upstream ENSMUSE00000101560 Chr11:11658198..11658320 No primer for this exon
upstream ENSMUSE00000444638 Chr11:11661222..11661356 No primer for this exon
upstream ENSMUSE00000681154 Chr11:11661222..11661427 No primer for this exon

*** Putative Vector Insertion (Chr 11: 11661428 - 11668717) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681161 Chr11:11668718..11668723 No primer for this exon
downstream ENSMUSE00000444629 Chr11:11668884..11672056 No primer for this exon
downstream ENSMUSE00000581055 Chr11:11668884..11672929 No primer for this exon
downstream ENSMUSE00000479354 Chr11:11668887..11669584 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTAATCGCCTTGCAGCAC Chr11:11667476..11667496 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATTATTCGTGACTGGGAAAACC Chr11:11667472..11667495 59.28 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018654