Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30192
Trapped Gene
Nes (ENSMUSG00000004891)
Vector Insertion
Chr 3: 87779342 - 87780503
Public Clones D085A07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710109 (Chr3:87779343..87780502 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710109 (Chr3:87779343..87780502 +)
Downstram Exon
ENSMUSE00000567238 (Chr3:87779343..87784369 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000333301 Chr3:87775015..87775910 No primer for this exon
upstream ENSMUSE00000721266 Chr3:87775051..87775910 No primer for this exon
upstream ENSMUSE00000175774 Chr3:87776914..87777038 No primer for this exon
upstream ENSMUSE00000175771 Chr3:87778724..87778797 No primer for this exon

*** Putative Vector Insertion (Chr 3: 87779342 - 87780503) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000567238 Chr3:87779343..87784369 No primer for this exon
downstream ENSMUSE00000710109 Chr3:87779343..87780502 No primer for this exon
downstream ENSMUSE00000722013 Chr3:87780635..87784373 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGGATACCAGAGGACCAG Chr3:87779368..87779388 59.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGGATACCAGAGGACCAG Chr3:87779368..87779388 59.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004891