Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30197
Trapped Gene
Pigv (ENSMUSG00000043257)
Vector Insertion
Chr 4: 133220572 - 133225776
Public Clones D082B05 (ggtc) D082B05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000597676 (Chr4:133225653..133225775 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTTAGAAGCCGGAGGAAGC Chr4:133225755..133225774 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000597676 (Chr4:133225653..133225775 -)
Downstram Exon
ENSMUSE00000388391 (Chr4:133220573..133221694 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTTAGAAGCCGGAGGAAGC Chr4:133225755..133225774 59.82 50 CACGGAGAACAGCAAGTTGA Chr4:133221367..133221386 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435847 Chr4:133228234..133228513 TAGGCGGAGGCTGTAGAGAA Chr4:133228380..133228399 60.11 55
upstream ENSMUSE00000597676 Chr4:133225653..133225775 ATTTAGAAGCCGGAGGAAGC Chr4:133225755..133225774 59.82 50
upstream ENSMUSE00000388391 Chr4:133220573..133221694 GCACGGCTACCTTTATGAGC Chr4:133221526..133221545 59.87 55

*** Putative Vector Insertion (Chr 4: 133220572 - 133225776) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000631004 Chr4:133217343..133218706 GAAGCAGGTGAGCTGGAAAC Chr4:133218621..133218640 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTTGCTTTTGGCCTGTGT Chr4:133225800..133225820 60.12 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTTGCTTTTGGCCTGTGT Chr4:133225800..133225820 60.12 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043257