Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30214
Trapped Gene
Fig4 (ENSMUSG00000038417)
Vector Insertion
Chr 10: 40907977 - 40940792
Public Clones D077F02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000298903 (Chr10:40940705..40940791 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAACAGGACCGAGGTAACCA Chr10:40940744..40940763 59.45 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000298903 (Chr10:40940705..40940791 -)
Downstram Exon
ENSMUSE00000298895 (Chr10:40907978..40908505 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAACAGGACCGAGGTAACCA Chr10:40940744..40940763 59.45 50 TTGTCTTGCGAGAAAGCTGA Chr10:40908454..40908473 59.86 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000299043 Chr10:41022793..41023047 GTCTGGTGTGCTGGAGGTCT Chr10:41022958..41022977 60.31 60
upstream ENSMUSE00000299038 Chr10:41005407..41005505 TTGGTGGTAATCGACGACAG Chr10:41005408..41005427 59.57 50
upstream ENSMUSE00000299036 Chr10:41005096..41005219 CCGTCTCAGCTTTTGGAGTC Chr10:41005100..41005119 59.99 55
upstream ENSMUSE00000299032 Chr10:40997164..40997320 GATGGCAGACATTGGAGGTC Chr10:40997246..40997265 60.48 55
upstream ENSMUSE00000299027 Chr10:40992764..40992814 No primer for this exon
upstream ENSMUSE00000299022 Chr10:40990105..40990253 ATCTTACCGTCCTGCGAATG Chr10:40990199..40990218 60.1 50
upstream ENSMUSE00000299017 Chr10:40987493..40987621 ACACTGTGCATCGTGACTGG Chr10:40987530..40987549 60.82 55
upstream ENSMUSE00000299011 Chr10:40985192..40985292 TCTCAAGAGAGGCGCAAACT Chr10:40985197..40985216 60.28 50
upstream ENSMUSE00000299003 Chr10:40983691..40983853 CAACTATGATGCCGAAACCA Chr10:40983701..40983720 59.54 45
upstream ENSMUSE00000298997 Chr10:40982875..40982972 CCCCCATCATCATCTTGAAC Chr10:40982884..40982903 60.13 50
upstream ENSMUSE00000298991 Chr10:40977821..40977954 AAGCACGAAAGGATCCTGAG Chr10:40977920..40977939 59.43 50
upstream ENSMUSE00000298986 Chr10:40976227..40976343 CGGAAAGCGTGGTAAAGAAG Chr10:40976286..40976305 59.88 50
upstream ENSMUSE00000298981 Chr10:40974650..40974695 TCATGTGATTCCCACTGGTC Chr10:40974658..40974677 59.32 50
upstream ENSMUSE00000298977 Chr10:40973446..40973594 GCATCCTTCGAACCAACTGT Chr10:40973571..40973590 60.12 50
upstream ENSMUSE00000298967 Chr10:40971523..40971689 TGGTTCATCGGGTAAAGACC Chr10:40971605..40971624 59.79 50
upstream ENSMUSE00000298961 Chr10:40960311..40960449 GGGAACTCCCCACAGACTTT Chr10:40960358..40960377 60.35 55
upstream ENSMUSE00000298954 Chr10:40953358..40953416 CTTACTGGTGGACGCCAGAG Chr10:40953392..40953411 60.84 60
upstream ENSMUSE00000298944 Chr10:40951913..40952060 TGATGACACCTTTTGCTTGG Chr10:40951932..40951951 59.69 45
upstream ENSMUSE00000298937 Chr10:40949813..40949896 ATTTACCGTGCGAAAACCAG Chr10:40949838..40949857 60 45
upstream ENSMUSE00000298926 Chr10:40947913..40948108 GATGACTGACACGGGAGACA Chr10:40947930..40947949 59.67 55
upstream ENSMUSE00000298912 Chr10:40946728..40946810 AGCCTGTCAGAGGAGGATCA Chr10:40946743..40946762 59.94 55
upstream ENSMUSE00000298903 Chr10:40940705..40940791 AAACAGGACCGAGGTAACCA Chr10:40940744..40940763 59.45 50
upstream ENSMUSE00000298895 Chr10:40907978..40908505 ATCACAGCCTTCGGTGATTC Chr10:40908219..40908238 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTGGTGTAATCGCCTTGC Chr10:40910729..40910749 59.97 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGTACACGTGACTGGGAAAA Chr10:40910727..40910749 60.07 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038417