Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30216
Trapped Gene
Hira (ENSMUSG00000022702)
Vector Insertion
Chr 16: 18877613 - 18894866
Public Clones (sanger) D075E03 (ggtc) IST14799E10 (tigm) IST13058F7 (tigm) IST14918G5 (tigm)
IST11567G11 (tigm) IST10074A2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000270336 (Chr16:18876843..18877612 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTAATAAATGCGCCCGTCT Chr16:18876909..18876928 59.7 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000270336 (Chr16:18876843..18877612 +)
Downstram Exon
ENSMUSE00000460992 (Chr16:18894867..18894929 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTAATAAATGCGCCCGTCT Chr16:18876909..18876928 59.7 45 GTTGCAAACTTGGTCCCATC Chr16:18894921..18894940 60.36 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000270336 Chr16:18876843..18877612 TCTAATAAATGCGCCCGTCT Chr16:18876909..18876928 59.7 45
upstream ENSMUSE00000719731 Chr16:18877130..18877307 ATCAGTGGCAGCGGAGTATC Chr16:18877204..18877223 60.25 55

*** Putative Vector Insertion (Chr 16: 18877613 - 18894866) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000460992 Chr16:18894867..18894929 GTTGCAAACTTGGTCCCATC Chr16:18894921..18894940 60.36 50
downstream ENSMUSE00000711859 Chr16:18894867..18894929 GTTGCAAACTTGGTCCCATC Chr16:18894921..18894940 60.36 50
downstream ENSMUSE00000464065 Chr16:18896547..18896657 TCCTTCTCGTCATCCTCCTG Chr16:18896616..18896635 60.34 55
downstream ENSMUSE00000711463 Chr16:18896547..18896657 TCCTTCTCGTCATCCTCCTG Chr16:18896616..18896635 60.34 55
downstream ENSMUSE00000129623 Chr16:18897791..18897881 GTTTGTCATCTCCCCCAGAA Chr16:18897859..18897878 59.9 50
downstream ENSMUSE00000129642 Chr16:18899456..18899550 GGCAAGCTTACCACTGGAAC Chr16:18899504..18899523 59.74 55
downstream ENSMUSE00000129640 Chr16:18910741..18910836 AACTTCACGGCATTCCAAAT Chr16:18910834..18910853 59.43 40
downstream ENSMUSE00000129643 Chr16:18912139..18912299 GGGATCCCAAGTCAAACCTT Chr16:18912200..18912219 60.17 50
downstream ENSMUSE00000129619 Chr16:18916533..18916700 GTGACCAACTAAGCCGGAGA Chr16:18916575..18916594 60.26 55
downstream ENSMUSE00000129622 Chr16:18919069..18919182 ACAGAGAGTGAGCGGTCCTT Chr16:18919181..18919200 59.05 55
downstream ENSMUSE00000129634 Chr16:18922410..18922480 No primer for this exon
downstream ENSMUSE00000129618 Chr16:18922947..18923052 GGTCTCCGAGTTCATCCTGA Chr16:18923035..18923054 60.2 55
downstream ENSMUSE00000129641 Chr16:18925741..18925956 GTCTCCGCTGGTACTTGAGC Chr16:18925852..18925871 60.02 60
downstream ENSMUSE00000129636 Chr16:18927531..18927616 GCTATGCAAAGAGGCGTGAT Chr16:18927604..18927623 60.38 50
downstream ENSMUSE00000714973 Chr16:18927531..18928123 GGCCAACAAGTGGAGACATT Chr16:18927832..18927851 59.97 50
downstream ENSMUSE00000129630 Chr16:18932961..18933155 TGGGATGCTGTTGAAGAATG Chr16:18932997..18933016 59.65 45
downstream ENSMUSE00000484139 Chr16:18935111..18935272 CTGTGAACCGGGAATCAAAT Chr16:18935211..18935230 59.79 45
downstream ENSMUSE00000129612 Chr16:18946439..18946640 CTTCCTAGGGCGACCTTTCT Chr16:18946607..18946626 59.84 55
downstream ENSMUSE00000129613 Chr16:18947507..18947611 GACAGACACATGGCCTCCTT Chr16:18947553..18947572 60.12 55
downstream ENSMUSE00000129628 Chr16:18949229..18949377 TCAGGCGACTCAGCCTTATC Chr16:18949310..18949329 60.5 55
downstream ENSMUSE00000129610 Chr16:18951268..18951429 GGCGACCACAGGTAGAGAAC Chr16:18951332..18951351 59.73 60
downstream ENSMUSE00000129603 Chr16:18951750..18951808 TCTTTCACCACAACCACCTG Chr16:18951785..18951804 59.56 50
downstream ENSMUSE00000129615 Chr16:18952157..18952262 TGGGATTCCATGCTGTGTTA Chr16:18952209..18952228 59.92 45
downstream ENSMUSE00000129632 Chr16:18954088..18954210 GGCTAACGGTCCTGAACAAA Chr16:18954190..18954209 60.11 50
downstream ENSMUSE00000129611 Chr16:18954703..18954866 CATTCACAAGGTACCGAGCA Chr16:18954866..18954885 59.72 50
downstream ENSMUSE00000129621 Chr16:18956262..18956350 AGTGAACTGGACCCAGCAAG Chr16:18956318..18956337 60.3 55
downstream ENSMUSE00000413153 Chr16:18969533..18970399 ATCGAAGATTCTGCCCAATG Chr16:18969596..18969615 60.04 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTAGCCAGCCAAACTGGT Chr16:18877643..18877663 59.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTAGCCAGCCAAACTGGT Chr16:18877643..18877663 59.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022702