Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30221
Trapped Gene
Nf2 (ENSMUSG00000009073)
Vector Insertion
Chr 11: 4733000 - 4748989
Public Clones D073B05 (ggtc) D073B05 (ggtc) IST13841E10 (tigm) IST11568H3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000456636 (Chr11:4748875..4748988 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000456636 (Chr11:4748875..4748988 -)
Downstram Exon
ENSMUSE00000682067 (Chr11:4733001..4733136 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456636 Chr11:4748875..4748988 No primer for this exon
upstream ENSMUSE00000581392 Chr11:4748875..4749368 No primer for this exon
upstream ENSMUSE00000710927 Chr11:4748875..4749530 No primer for this exon
upstream ENSMUSE00000712691 Chr11:4748875..4749530 No primer for this exon
upstream ENSMUSE00000682067 Chr11:4733001..4733136 No primer for this exon

*** Putative Vector Insertion (Chr 11: 4733000 - 4748989) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000656076 Chr11:4720371..4720496 No primer for this exon
downstream ENSMUSE00000656088 Chr11:4720371..4720496 No primer for this exon
downstream ENSMUSE00000104218 Chr11:4718508..4718630 No primer for this exon
downstream ENSMUSE00000104220 Chr11:4716085..4716168 No primer for this exon
downstream ENSMUSE00000104229 Chr11:4708260..4708328 No primer for this exon
downstream ENSMUSE00000104227 Chr11:4706257..4706339 No primer for this exon
downstream ENSMUSE00000104225 Chr11:4703681..4703756 No primer for this exon
downstream ENSMUSE00000104215 Chr11:4699864..4699998 No primer for this exon
downstream ENSMUSE00000308293 Chr11:4694846..4694920 No primer for this exon
downstream ENSMUSE00000104231 Chr11:4694415..4694528 No primer for this exon
downstream ENSMUSE00000709587 Chr11:4691094..4691216 No primer for this exon
downstream ENSMUSE00000711364 Chr11:4691094..4691216 No primer for this exon
downstream ENSMUSE00000104239 Chr11:4689668..4689885 No primer for this exon
downstream ENSMUSE00000682063 Chr11:4689668..4689885 No primer for this exon
downstream ENSMUSE00000104236 Chr11:4687447..4687552 No primer for this exon
downstream ENSMUSE00000682061 Chr11:4687447..4687552 No primer for this exon
downstream ENSMUSE00000104222 Chr11:4684439..4684566 No primer for this exon
downstream ENSMUSE00000682059 Chr11:4684439..4684566 No primer for this exon
downstream ENSMUSE00000308256 Chr11:4682190..4682355 No primer for this exon
downstream ENSMUSE00000682057 Chr11:4682190..4682355 No primer for this exon
downstream ENSMUSE00000682066 Chr11:4681940..4682355 No primer for this exon
downstream ENSMUSE00000682080 Chr11:4680590..4680625 No primer for this exon
downstream ENSMUSE00000682077 Chr11:4680581..4680625 No primer for this exon
downstream ENSMUSE00000682068 Chr11:4672337..4672641 No primer for this exon
downstream ENSMUSE00000581387 Chr11:4667668..4668276 No primer for this exon
downstream ENSMUSE00000581399 Chr11:4665851..4668276 No primer for this exon
downstream ENSMUSE00000682054 Chr11:4665851..4668276 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTGTGATTAATCGCCTTG Chr11:4748927..4748947 60.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGATCGTGACTGGGAAAA Chr11:4748924..4748944 60.09 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009073