Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30222
Trapped Gene
Cdk8 (ENSMUSG00000029635)
Vector Insertion
Chr 5: 147043397 - 147071080
Public Clones D073B02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000453178 (Chr5:147043251..147043396 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTTACGGGCACGTCTACA Chr5:147043358..147043377 59.78 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000453178 (Chr5:147043251..147043396 +)
Downstram Exon
ENSMUSE00000452610 (Chr5:147071081..147071156 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTTACGGGCACGTCTACA Chr5:147043358..147043377 59.78 55 CTGCATGCCGACATAGAAAT Chr5:147071149..147071168 58.75 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684566 Chr5:147042826..147042910 No primer for this exon
upstream ENSMUSE00000684569 Chr5:147042961..147043396 CACTTACGGGCACGTCTACA Chr5:147043358..147043377 59.78 55
upstream ENSMUSE00000453178 Chr5:147043251..147043396 CACTTACGGGCACGTCTACA Chr5:147043358..147043377 59.78 55

*** Putative Vector Insertion (Chr 5: 147043397 - 147071080) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000452610 Chr5:147071081..147071156 CTGCATGCCGACATAGAAAT Chr5:147071149..147071168 58.75 45
downstream ENSMUSE00000684565 Chr5:147071081..147071156 CTGCATGCCGACATAGAAAT Chr5:147071149..147071168 58.75 45
downstream ENSMUSE00000452605 Chr5:147079791..147079901 TTCCGATCAGCATGAGACAG Chr5:147079864..147079883 59.94 50
downstream ENSMUSE00000684568 Chr5:147079791..147079862 TTCCGATCAGCATGAGACAG Chr5:147079864..147079883 59.94 50
downstream ENSMUSE00000452599 Chr5:147083171..147083311 GTTGGCTTTCGAAGCTCTGT Chr5:147083209..147083228 59.62 50
downstream ENSMUSE00000684567 Chr5:147083171..147083240 GTTGGCTTTCGAAGCTCTGT Chr5:147083209..147083228 59.62 50
downstream ENSMUSE00000452594 Chr5:147095205..147095262 GCTCAGGACCTTCACCCATA Chr5:147095247..147095266 60.07 55
downstream ENSMUSE00000452593 Chr5:147097684..147097815 CGCTCCGAGGAGTAATTCTG Chr5:147097796..147097815 59.97 55
downstream ENSMUSE00000452591 Chr5:147104200..147104343 TGCAGGGAATCCCATTACAT Chr5:147104345..147104364 60.15 45
downstream ENSMUSE00000684564 Chr5:147104215..147104343 TGCAGGGAATCCCATTACAT Chr5:147104345..147104364 60.15 45
downstream ENSMUSE00000684562 Chr5:147106486..147106808 GTTGAATGTTCGGGCATCTT Chr5:147106784..147106803 59.94 45
downstream ENSMUSE00000452590 Chr5:147106739..147106808 GTTGAATGTTCGGGCATCTT Chr5:147106784..147106803 59.94 45
downstream ENSMUSE00000190928 Chr5:147107935..147108007 TTGATAAGGCTGCAATTGGT Chr5:147107961..147107980 58.24 40
downstream ENSMUSE00000190917 Chr5:147110379..147110476 GCCTGCTCTGAGGTAATTCG Chr5:147110434..147110453 59.98 55
downstream ENSMUSE00000190935 Chr5:147111074..147111152 TCGTTTGGGATATGGGATCT Chr5:147111113..147111132 59.2 45
downstream ENSMUSE00000190931 Chr5:147111268..147111426 GCCAGTTCCGTTAGTGTGGT Chr5:147111318..147111337 60.03 55
downstream ENSMUSE00000333428 Chr5:147113152..147114395 AGCTACCACCCCAATCTGTG Chr5:147113440..147113459 59.99 55
downstream ENSMUSE00000684563 Chr5:147113152..147114407 AGCTACCACCCCAATCTGTG Chr5:147113440..147113459 59.99 55
downstream ENSMUSE00000684571 Chr5:147113152..147114450 AGCTACCACCCCAATCTGTG Chr5:147113440..147113459 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGGGCTTGGCAAGGTAAT Chr5:147067432..147067452 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGTAGGAGGCAGAGGGTGT Chr5:147067409..147067430 61.22 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029635