Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30236
Trapped Gene
Eif2s2 (ENSMUSG00000074656)
Vector Insertion
Chr 2: 154699284 - 154702409
Public Clones D068G02 (ggtc) D068G02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639766 (Chr2:154702352..154702408 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTCAACCCAAACATCTCCT Chr2:154702382..154702401 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639766 (Chr2:154702352..154702408 -)
Downstram Exon
ENSMUSE00000639765 (Chr2:154699285..154699370 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTCAACCCAAACATCTCCT Chr2:154702382..154702401 59.97 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681253 Chr2:154718426..154718553 TGCGGTGCTGTGAGAAGTAT Chr2:154718523..154718542 59.47 50
upstream ENSMUSE00000639772 Chr2:154713919..154714096 AAAAAGACGTGGACGCTGAT Chr2:154713941..154713960 59.74 45
upstream ENSMUSE00000639771 Chr2:154713440..154713543 TTTGACATTGATGAAGCTGAAGA Chr2:154713450..154713472 59.88 34.78
upstream ENSMUSE00000639770 Chr2:154710047..154710182 TGACATTATGCTTGGCAACAA Chr2:154710109..154710129 60.13 38.1
upstream ENSMUSE00000639769 Chr2:154704206..154704300 GGCAGGCTCAGAAAGAGACT Chr2:154704220..154704239 58.77 55
upstream ENSMUSE00000639767 Chr2:154703407..154703555 CAGGTCGTCCGAGTAGGAAC Chr2:154703449..154703468 59.72 60
upstream ENSMUSE00000639766 Chr2:154702352..154702408 CGTCAACCCAAACATCTCCT Chr2:154702382..154702401 59.97 50
upstream ENSMUSE00000639765 Chr2:154699285..154699370 No primer for this exon

*** Putative Vector Insertion (Chr 2: 154699284 - 154702409) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639763 Chr2:154698173..154698636 TGTAGGATTGTGTCCGGTGA Chr2:154698566..154698585 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000074656