Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30239
Trapped Gene
Gcnt2 (ENSMUSG00000021360)
Vector Insertion
Chr 13: 40956643 - 40982534
Public Clones (sanger) (ggtc) (ggtc) D067E06 (ggtc) IST14653C8 (tigm) IST11523E3 (tigm)
IST13119D9 (tigm) IST10671B12 (tigm) IST14405B12 (tigm) IST13912H11 (tigm)
IST14033E8 (tigm) IST13970F5 (tigm) IST12388E5 (tigm) IST12130F8 (tigm)
IST11041E6 (tigm) IST13828F9 (tigm) IST12390F5 (tigm) IST12604C12 (tigm)
IST12131H11 (tigm) IST12657A10 (tigm) IST12348F8 (tigm) IST13862H2 (tigm)
IST11547H8 (tigm) IST12572C10 (tigm) IST13929H9 (tigm) IST11225H4 (tigm)
IST13862H2 (tigm) IST12134B1 (tigm) IST13650D9 (tigm) IST13096C5 (tigm)
IST13912H11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683059 (Chr13:40955501..40956642 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683059 (Chr13:40955501..40956642 +)
Downstram Exon
ENSMUSE00000500581 (Chr13:40982535..40983654 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683059 Chr13:40955501..40956642 No primer for this exon

*** Putative Vector Insertion (Chr 13: 40956643 - 40982534) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000500581 Chr13:40982535..40983654 No primer for this exon
downstream ENSMUSE00000683058 Chr13:40982736..40983658 No primer for this exon
downstream ENSMUSE00000683057 Chr13:40984564..40984579 No primer for this exon
downstream ENSMUSE00000288319 Chr13:41013003..41014170 No primer for this exon
downstream ENSMUSE00000446426 Chr13:41048945..41049040 No primer for this exon
downstream ENSMUSE00000446420 Chr13:41053521..41056260 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTTTTTAATCGCCTTGCAG Chr13:40980687..40980708 59.9 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATAGCCGTGACTGGGAAAA Chr13:40980688..40980708 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021360