Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30250
Trapped Gene
Bnc2 (ENSMUSG00000028487)
Vector Insertion
Chr 4: 84152431 - 84192238
Public Clones D062E09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662706 (Chr4:84192109..84192237 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGCAAAACGCTGACACTA Chr4:84192135..84192154 59.35 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662706 (Chr4:84192109..84192237 -)
Downstram Exon
ENSMUSE00000468368 (Chr4:84152432..84152515 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGCAAAACGCTGACACTA Chr4:84192135..84192154 59.35 45 AAGTCTGCACCCAGCACTCT Chr4:84152453..84152472 60.06 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672378 Chr4:84320879..84320990 CCGCTAAGAGGAGACCAAGA Chr4:84320916..84320935 59.57 55
upstream ENSMUSE00000632105 Chr4:84201683..84201808 CATTTTAAGGTCCCGTGCTG Chr4:84201708..84201727 60.49 50
upstream ENSMUSE00000443683 Chr4:84192109..84192309 ATGGCAAAACGCTGACACTA Chr4:84192135..84192154 59.35 45
upstream ENSMUSE00000662706 Chr4:84192109..84192237 ATGGCAAAACGCTGACACTA Chr4:84192135..84192154 59.35 45
upstream ENSMUSE00000468368 Chr4:84152432..84152515 AAACCTGGAGGAACCAGACC Chr4:84152449..84152468 60.35 55

*** Putative Vector Insertion (Chr 4: 84152431 - 84192238) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000603220 Chr4:84060150..84060252 CACACGTGCAGTTTACCAATG Chr4:84060197..84060217 60.08 47.62
downstream ENSMUSE00000469416 Chr4:84036793..84037028 ATGTCAAACACCACGTTGGA Chr4:84036928..84036947 59.85 45
downstream ENSMUSE00000179656 Chr4:83937597..83939566 CCATGTTGCAACCTTCAATG Chr4:83938779..83938798 59.96 45
downstream ENSMUSE00000518854 Chr4:83920999..83922351 ATTTGGAGTGTCCGTTCTGG Chr4:83921647..83921666 59.97 50
downstream ENSMUSE00000672376 Chr4:83920748..83922351 ATTTGGAGTGTCCGTTCTGG Chr4:83921647..83921666 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTAATCGCCTTGCAGCAC Chr4:84165170..84165190 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCATGGATTTCAGGGTTGA Chr4:84174256..84174276 58.9 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028487