Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30261
Trapped Gene
Gfod2 (ENSMUSG00000013150)
Vector Insertion
Chr 8: 108251887 - 108282508
Public Clones D054E06 (ggtc) D054E06 (ggtc) IST10885F3 (tigm) IST12646C2 (tigm)
IST12485H6 (tigm) IST11825B2 (tigm) IST13960F6 (tigm) IST10524A6 (tigm)
IST14206G6 (tigm) IST12427H12 (tigm) IST12421F12 (tigm) IST11825B1 (tigm)
IST12810G1 (tigm) IST14623C2 (tigm) IST15059D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214437 (Chr8:108282354..108282507 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214437 (Chr8:108282354..108282507 -)
Downstram Exon
ENSMUSE00000214439 (Chr8:108251888..108252231 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000214437 Chr8:108282354..108282507 No primer for this exon
upstream ENSMUSE00000214439 Chr8:108251888..108252231 No primer for this exon

*** Putative Vector Insertion (Chr 8: 108251887 - 108282508) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000606011 Chr8:108240013..108241550 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTTGGTTATTTGAAAATGGA Chr8:108270526..108270548 58.04 31.82 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTTGGTTATTTGAAAATGGA Chr8:108270526..108270548 58.04 31.82 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013150