Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30271
Trapped Gene
Rbm6 (ENSMUSG00000032582)
Vector Insertion
Chr 9: 107754455 - 107762791
Public Clones D051G03 (ggtc) D051F03 (ggtc) D051G03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454980 (Chr9:107762680..107762790 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCACCGTGCTAGAGTTTGG Chr9:107762769..107762788 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454980 (Chr9:107762680..107762790 -)
Downstram Exon
ENSMUSE00000221165 (Chr9:107754456..107756005 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCACCGTGCTAGAGTTTGG Chr9:107762769..107762788 60.17 55 CCCATTTCAGAACACGAGGT Chr9:107755910..107755929 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634400 Chr9:107774980..107775038 No primer for this exon
upstream ENSMUSE00000691183 Chr9:107774980..107775152 No primer for this exon
upstream ENSMUSE00000454980 Chr9:107762680..107762790 ACCACCGTGCTAGAGTTTGG Chr9:107762769..107762788 60.17 55
upstream ENSMUSE00000221165 Chr9:107754456..107756005 TTTCTCAGGGCAAAATGTCC Chr9:107754480..107754499 60.05 45
upstream ENSMUSE00000691182 Chr9:107754456..107755734 TTTCTCAGGGCAAAATGTCC Chr9:107754480..107754499 60.05 45

*** Putative Vector Insertion (Chr 9: 107754455 - 107762791) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221168 Chr9:107753246..107753335 TTAGGTTTCTCCTCGCTTGG Chr9:107753273..107753292 59.45 50
downstream ENSMUSE00000221163 Chr9:107749599..107749668 TGCCATCAGAAGTTCGAAAG Chr9:107749616..107749635 59 45
downstream ENSMUSE00000454954 Chr9:107735765..107735838 TCCACGCAGACATAGCCATA Chr9:107735789..107735808 60.24 50
downstream ENSMUSE00000221167 Chr9:107703030..107703104 CCAAAAATCTGGGCTTGGTA Chr9:107703020..107703039 59.93 45
downstream ENSMUSE00000221166 Chr9:107698808..107698868 CCACCAGTGCTAGCCTTACA Chr9:107698827..107698846 58.95 55
downstream ENSMUSE00000221161 Chr9:107694083..107694349 CTCCTTTTCCCGGTCTCTTC Chr9:107694101..107694120 60.18 55
downstream ENSMUSE00000250818 Chr9:107693336..107693496 GGGTGGAGTGGAACGATAGA Chr9:107693437..107693456 59.93 55
downstream ENSMUSE00000250794 Chr9:107691939..107692036 TTTCCAGTGGCCAGGTTTAC Chr9:107691923..107691942 59.97 50
downstream ENSMUSE00000454923 Chr9:107690661..107690703 AATGCATGTGGTCAGAATGG Chr9:107690647..107690666 59.37 45
downstream ENSMUSE00000250753 Chr9:107690439..107690520 TTGCCCTTGTCGATTTGTATC Chr9:107690421..107690441 59.95 42.86
downstream ENSMUSE00000334993 Chr9:107690110..107690195 CCTGCCAAGGGGTCATAATA Chr9:107690113..107690132 59.78 50
downstream ENSMUSE00000250716 Chr9:107689583..107689729 TCCTGGGGCACATAGACTTC Chr9:107689685..107689704 60.07 55
downstream ENSMUSE00000250692 Chr9:107686021..107686116 GGCTTCCCCTCACTGGTACT Chr9:107686066..107686085 60.51 60
downstream ENSMUSE00000250672 Chr9:107684941..107685195 CACCCAGGAGACCAATCAGT Chr9:107685137..107685156 59.96 55
downstream ENSMUSE00000250644 Chr9:107681905..107681979 TCCAGATAGGCGAGCTCTTG Chr9:107681899..107681918 60.64 55
downstream ENSMUSE00000250611 Chr9:107680261..107680358 CCCTTCGGTCATTTCCTTTT Chr9:107680303..107680322 60.29 45
downstream ENSMUSE00000250591 Chr9:107676923..107677052 TCCTCTGATGAACCCAATCC Chr9:107676902..107676921 59.86 50
downstream ENSMUSE00000389387 Chr9:107675896..107676138 CGAACAGCGTCTCGGTAAGT Chr9:107676028..107676047 60.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCTTAATCGCCTTGCAG Chr9:107759726..107759746 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCTCGTGACTGGGAAAAC Chr9:107759725..107759745 59.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032582