Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30274
Trapped Gene
Zfp395 (ENSMUSG00000034522)
Vector Insertion
Chr 14: 65994387 - 66003789
Public Clones (ggtc) D050C08 (ggtc) (ggtc) D050C08 (ggtc) (ggtc) IST14779D6 (tigm)
IST14755C7 (tigm) IST12844D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000513386 (Chr14:65994230..65994386 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGATGCAGTCTCACCCTCA Chr14:65994364..65994383 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000513386 (Chr14:65994230..65994386 +)
Downstram Exon
ENSMUSE00000686936 (Chr14:66003790..66003803 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGATGCAGTCTCACCCTCA Chr14:65994364..65994383 59.98 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513386 Chr14:65994230..65994386 CAGATGCAGTCTCACCCTCA Chr14:65994364..65994383 59.98 55

*** Putative Vector Insertion (Chr 14: 65994387 - 66003789) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000686936 Chr14:66003790..66003803 No primer for this exon
downstream ENSMUSE00000686934 Chr14:66004233..66004497 GGTACTTCAGCGGCACTAGG Chr14:66004331..66004350 59.9 60
downstream ENSMUSE00000270891 Chr14:66004236..66004497 GGTACTTCAGCGGCACTAGG Chr14:66004331..66004350 59.9 60
downstream ENSMUSE00000557517 Chr14:66005164..66005396 GGGACGTCGATGTTCCTAGA Chr14:66005393..66005412 60.07 55
downstream ENSMUSE00000686933 Chr14:66005164..66005265 TTGCACTCCTGACCTCCATA Chr14:66005198..66005217 59.24 50
downstream ENSMUSE00000520419 Chr14:66007627..66007736 TGCAAGACAGAGACGTCAGC Chr14:66007694..66007713 60.34 55
downstream ENSMUSE00000270864 Chr14:66010124..66010353 GGCTGGTTCGTCTAACAGGA Chr14:66010341..66010360 60.26 55
downstream ENSMUSE00000270852 Chr14:66010892..66010992 CCCACAATTGAACGGAGAAC Chr14:66010962..66010981 60.35 50
downstream ENSMUSE00000270845 Chr14:66011757..66012057 AGCTGACTTGCTGAGTGCAA Chr14:66012018..66012037 59.93 50
downstream ENSMUSE00000614694 Chr14:66013593..66013685 GATCTGGAAGGATGGCAGAG Chr14:66013616..66013635 59.76 55
downstream ENSMUSE00000270828 Chr14:66014692..66014795 GGAGGTGACAATCAGGTGAGA Chr14:66014771..66014791 60.1 52.38
downstream ENSMUSE00000686932 Chr14:66014744..66014795 GGAGGTGACAATCAGGTGAGA Chr14:66014771..66014791 60.1 52.38
downstream ENSMUSE00000423312 Chr14:66015056..66015735 CCGTACACCTTACGGCACTT Chr14:66015100..66015119 60.05 55
downstream ENSMUSE00000571650 Chr14:66015056..66015735 CCGTACACCTTACGGCACTT Chr14:66015100..66015119 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATGCAGTCTCACCCTCACA Chr14:65994367..65994387 59.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGCAGTCTCACCCTCACA Chr14:65994367..65994387 59.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034522