Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30277
Trapped Gene
Adar (ENSMUSG00000027951)
Vector Insertion
Chr 3: 89534761 - 89538763
Public Clones D048H03 (ggtc) D048H03 (ggtc) (ggtc) IST14530E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716327 (Chr3:89534706..89534760 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716327 (Chr3:89534706..89534760 +)
Downstram Exon
ENSMUSE00000638130 (Chr3:89538764..89540195 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TACCAGATGGGAGGAGTTGC Chr3:89539658..89539677 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638131 Chr3:89518982..89519072 GACTACGCGTTGGGACTAGC Chr3:89518996..89519015 59.9 60
upstream ENSMUSE00000722205 Chr3:89534670..89534760 No primer for this exon
upstream ENSMUSE00000709449 Chr3:89534706..89534760 No primer for this exon
upstream ENSMUSE00000716327 Chr3:89534706..89534760 No primer for this exon

*** Putative Vector Insertion (Chr 3: 89534761 - 89538763) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000339286 Chr3:89538764..89540195 TACCAGATGGGAGGAGTTGC Chr3:89539658..89539677 60.07 55
downstream ENSMUSE00000638130 Chr3:89538764..89540195 TACCAGATGGGAGGAGTTGC Chr3:89539658..89539677 60.07 55
downstream ENSMUSE00000174606 Chr3:89541912..89542095 CGTCCTGCTTGGCTACTTTC Chr3:89541994..89542013 60.01 55
downstream ENSMUSE00000715096 Chr3:89541912..89542095 CGTCCTGCTTGGCTACTTTC Chr3:89541994..89542013 60.01 55
downstream ENSMUSE00000174601 Chr3:89543092..89543240 AGGAGACGGAATTCACAGGA Chr3:89543213..89543232 59.65 50
downstream ENSMUSE00000174612 Chr3:89543755..89543893 TGGGCTCCTACTGCTACACA Chr3:89543787..89543806 59.47 55
downstream ENSMUSE00000174611 Chr3:89544016..89544200 TGAGTCTGTGTTCGCACCTC Chr3:89544042..89544061 60.03 55
downstream ENSMUSE00000307992 Chr3:89549298..89549445 CCCCAACTTTTGCTTGGTAA Chr3:89549326..89549345 59.97 45
downstream ENSMUSE00000638128 Chr3:89549298..89549523 TTACCTCTGCGAAACCCAAC Chr3:89549452..89549471 60.11 50
downstream ENSMUSE00000307986 Chr3:89549742..89549913 CTCACGACAACACCCATGTC Chr3:89549905..89549924 60.01 55
downstream ENSMUSE00000174600 Chr3:89550487..89550580 GGCAGTCATTGACCGTCTCT Chr3:89550549..89550568 60.27 55
downstream ENSMUSE00000174599 Chr3:89551094..89551216 CCTGGCAAGCTCAAATATGC Chr3:89551166..89551185 60.74 50
downstream ENSMUSE00000174605 Chr3:89551460..89551593 GGTCACTGCAGGATTTGTCA Chr3:89551512..89551531 59.68 50
downstream ENSMUSE00000174610 Chr3:89553559..89553741 AGCACATTCCAGCGTAGGAT Chr3:89553679..89553698 59.72 50
downstream ENSMUSE00000174604 Chr3:89554158..89554270 GCAAATAGCACGGGTCAGAT Chr3:89554201..89554220 60.1 50
downstream ENSMUSE00000174609 Chr3:89554550..89554677 ACCAGTTGACGCTTGTTTCC Chr3:89554622..89554641 60.16 50
downstream ENSMUSE00000174608 Chr3:89554851..89555327 TAGTCACGGGCAGCTTTCTT Chr3:89554985..89555004 60.01 50
downstream ENSMUSE00000638126 Chr3:89554851..89557367 AAACCCAGAACCACTCGTTG Chr3:89556943..89556962 60.01 50
downstream ENSMUSE00000714502 Chr3:89554851..89555328 TAGTCACGGGCAGCTTTCTT Chr3:89554985..89555004 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTAATCGCCTTGCAGCAC Chr3:89534809..89534829 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGGAGAGCCTCGTGACTG Chr3:89537800..89537820 60.61 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027951